ID: 1122982190

View in Genome Browser
Species Human (GRCh38)
Location 14:105196862-105196884
Sequence CGGGACTCGGGACCGCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122982185_1122982190 -7 Left 1122982185 14:105196846-105196868 CCTCGGCAGGTGCGGCCGGGACT No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data
1122982171_1122982190 25 Left 1122982171 14:105196814-105196836 CCGGCTCGGCCTTCCCTCCTTCG No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data
1122982177_1122982190 11 Left 1122982177 14:105196828-105196850 CCTCCTTCGCGGCCTGGGCCTCG No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data
1122982176_1122982190 12 Left 1122982176 14:105196827-105196849 CCCTCCTTCGCGGCCTGGGCCTC No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data
1122982174_1122982190 16 Left 1122982174 14:105196823-105196845 CCTTCCCTCCTTCGCGGCCTGGG No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data
1122982182_1122982190 -1 Left 1122982182 14:105196840-105196862 CCTGGGCCTCGGCAGGTGCGGCC No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data
1122982170_1122982190 26 Left 1122982170 14:105196813-105196835 CCCGGCTCGGCCTTCCCTCCTTC No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data
1122982179_1122982190 8 Left 1122982179 14:105196831-105196853 CCTTCGCGGCCTGGGCCTCGGCA No data
Right 1122982190 14:105196862-105196884 CGGGACTCGGGACCGCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122982190 Original CRISPR CGGGACTCGGGACCGCAGGC CGG Intergenic
No off target data available for this crispr