ID: 1122982557

View in Genome Browser
Species Human (GRCh38)
Location 14:105198221-105198243
Sequence CCCCTCCCTCAGCAAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122982550_1122982557 20 Left 1122982550 14:105198178-105198200 CCAGCCCATGGCACTTCTTGCCA No data
Right 1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG No data
1122982553_1122982557 0 Left 1122982553 14:105198198-105198220 CCATCATCTCTACCAGCCACAGA No data
Right 1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG No data
1122982551_1122982557 16 Left 1122982551 14:105198182-105198204 CCCATGGCACTTCTTGCCATCAT No data
Right 1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG No data
1122982552_1122982557 15 Left 1122982552 14:105198183-105198205 CCATGGCACTTCTTGCCATCATC No data
Right 1122982557 14:105198221-105198243 CCCCTCCCTCAGCAAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122982557 Original CRISPR CCCCTCCCTCAGCAAGCCAC TGG Intergenic
No off target data available for this crispr