ID: 1122983194

View in Genome Browser
Species Human (GRCh38)
Location 14:105200691-105200713
Sequence ATGGAGAAGGGCCCAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122983194_1122983202 3 Left 1122983194 14:105200691-105200713 CCATCCTCTGGGCCCTTCTCCAT No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122983194 Original CRISPR ATGGAGAAGGGCCCAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr