ID: 1122983202

View in Genome Browser
Species Human (GRCh38)
Location 14:105200717-105200739
Sequence CTCCCCAGAGTGCTCCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122983197_1122983202 -10 Left 1122983197 14:105200704-105200726 CCTTCTCCATCCCCTCCCCAGAG No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983183_1122983202 25 Left 1122983183 14:105200669-105200691 CCGGCCCCACCCAGGGACACCCC No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983194_1122983202 3 Left 1122983194 14:105200691-105200713 CCATCCTCTGGGCCCTTCTCCAT No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983186_1122983202 19 Left 1122983186 14:105200675-105200697 CCACCCAGGGACACCCCCATCCT No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983196_1122983202 -9 Left 1122983196 14:105200703-105200725 CCCTTCTCCATCCCCTCCCCAGA No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983195_1122983202 -1 Left 1122983195 14:105200695-105200717 CCTCTGGGCCCTTCTCCATCCCC No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983187_1122983202 16 Left 1122983187 14:105200678-105200700 CCCAGGGACACCCCCATCCTCTG No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983185_1122983202 20 Left 1122983185 14:105200674-105200696 CCCACCCAGGGACACCCCCATCC No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983192_1122983202 5 Left 1122983192 14:105200689-105200711 CCCCATCCTCTGGGCCCTTCTCC No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983181_1122983202 29 Left 1122983181 14:105200665-105200687 CCTCCCGGCCCCACCCAGGGACA No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983184_1122983202 21 Left 1122983184 14:105200673-105200695 CCCCACCCAGGGACACCCCCATC No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983191_1122983202 6 Left 1122983191 14:105200688-105200710 CCCCCATCCTCTGGGCCCTTCTC No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983182_1122983202 26 Left 1122983182 14:105200668-105200690 CCCGGCCCCACCCAGGGACACCC No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983188_1122983202 15 Left 1122983188 14:105200679-105200701 CCAGGGACACCCCCATCCTCTGG No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data
1122983193_1122983202 4 Left 1122983193 14:105200690-105200712 CCCATCCTCTGGGCCCTTCTCCA No data
Right 1122983202 14:105200717-105200739 CTCCCCAGAGTGCTCCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122983202 Original CRISPR CTCCCCAGAGTGCTCCAAAA TGG Intergenic
No off target data available for this crispr