ID: 1122985231

View in Genome Browser
Species Human (GRCh38)
Location 14:105208794-105208816
Sequence AGGCCGGGAGCCCCTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122985226_1122985231 -6 Left 1122985226 14:105208777-105208799 CCCAGTGGCCATCTGCTAGGCCG No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data
1122985223_1122985231 -1 Left 1122985223 14:105208772-105208794 CCGGCCCCAGTGGCCATCTGCTA No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data
1122985225_1122985231 -5 Left 1122985225 14:105208776-105208798 CCCCAGTGGCCATCTGCTAGGCC No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data
1122985222_1122985231 0 Left 1122985222 14:105208771-105208793 CCCGGCCCCAGTGGCCATCTGCT No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data
1122985216_1122985231 26 Left 1122985216 14:105208745-105208767 CCATGCCACCTGGCTGTCGTCTC No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data
1122985219_1122985231 18 Left 1122985219 14:105208753-105208775 CCTGGCTGTCGTCTCTGGCCCGG No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data
1122985218_1122985231 21 Left 1122985218 14:105208750-105208772 CCACCTGGCTGTCGTCTCTGGCC No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data
1122985227_1122985231 -7 Left 1122985227 14:105208778-105208800 CCAGTGGCCATCTGCTAGGCCGG No data
Right 1122985231 14:105208794-105208816 AGGCCGGGAGCCCCTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122985231 Original CRISPR AGGCCGGGAGCCCCTCCAGC TGG Intergenic
No off target data available for this crispr