ID: 1122986112

View in Genome Browser
Species Human (GRCh38)
Location 14:105212450-105212472
Sequence GGCACCAGGCAGCTCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 226}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122986112_1122986117 -5 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986117 14:105212468-105212490 GTGCCCTACCTCACTCAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 138
1122986112_1122986127 8 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986127 14:105212481-105212503 CTCAGGGAGGAGGGGAGGGAGGG 0: 1
1: 3
2: 27
3: 360
4: 3528
1122986112_1122986121 -1 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986121 14:105212472-105212494 CCTACCTCACTCAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 25
4: 189
1122986112_1122986128 14 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986128 14:105212487-105212509 GAGGAGGGGAGGGAGGGTGAAGG 0: 1
1: 6
2: 110
3: 1297
4: 9180
1122986112_1122986124 3 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986124 14:105212476-105212498 CCTCACTCAGGGAGGAGGGGAGG 0: 1
1: 0
2: 1
3: 60
4: 545
1122986112_1122986119 -2 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986119 14:105212471-105212493 CCCTACCTCACTCAGGGAGGAGG 0: 1
1: 0
2: 1
3: 20
4: 376
1122986112_1122986129 15 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986129 14:105212488-105212510 AGGAGGGGAGGGAGGGTGAAGGG 0: 1
1: 2
2: 109
3: 1444
4: 10299
1122986112_1122986116 -8 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986116 14:105212465-105212487 CTGGTGCCCTACCTCACTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 114
1122986112_1122986122 0 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986122 14:105212473-105212495 CTACCTCACTCAGGGAGGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 181
1122986112_1122986126 7 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986126 14:105212480-105212502 ACTCAGGGAGGAGGGGAGGGAGG 0: 1
1: 0
2: 13
3: 252
4: 3527
1122986112_1122986125 4 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986125 14:105212477-105212499 CTCACTCAGGGAGGAGGGGAGGG 0: 1
1: 0
2: 5
3: 62
4: 544
1122986112_1122986115 -9 Left 1122986112 14:105212450-105212472 CCCTCAAGGAGCTGCCTGGTGCC 0: 1
1: 0
2: 4
3: 31
4: 226
Right 1122986115 14:105212464-105212486 CCTGGTGCCCTACCTCACTCAGG 0: 1
1: 0
2: 0
3: 38
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122986112 Original CRISPR GGCACCAGGCAGCTCCTTGA GGG (reversed) Intronic
900196144 1:1376528-1376550 GGCACCAGTCTGCTCATTTACGG - Intergenic
900217815 1:1490985-1491007 GCCAACAGGCACCTCCTAGAGGG + Intronic
900399269 1:2466383-2466405 GGCAGGAGGCAGCTCCTTTGAGG + Intronic
900528417 1:3140663-3140685 GCCACCAGGCAGCTCCTAGAAGG + Intronic
900835905 1:5003798-5003820 GGCAGCATGCAGCTCCCTGATGG + Intergenic
901332991 1:8424664-8424686 GGCAGACTGCAGCTCCTTGAGGG - Intronic
901515338 1:9741522-9741544 GGCACCAGGAAGTTCCTGTATGG + Intronic
901693771 1:10991405-10991427 GGCCCCTGTCAGCTTCTTGATGG + Intergenic
902556850 1:17251964-17251986 GGCACCAATCAGACCCTTGAAGG + Intronic
902574974 1:17372069-17372091 GCCACCAGGAAGCTCTTAGAGGG + Intergenic
902925765 1:19694772-19694794 AGCACCAGGTAGCTCCATGAAGG + Intronic
903003435 1:20282635-20282657 GGCCCCAGGCAGCTCACTGATGG - Intergenic
905484737 1:38287250-38287272 GGCAAAAGGCAGCTGCTTGCAGG + Intergenic
905850756 1:41272862-41272884 GGCACTAGGCAGGGCCTGGATGG + Intergenic
906719206 1:47993569-47993591 GGTCCCAGGCAACTCCTTGTTGG + Intronic
906773514 1:48507063-48507085 GGCACCATGCAACACATTGAAGG + Intergenic
908826934 1:68142146-68142168 GGCAACATGCAGCTGCTTCAGGG + Intronic
912385230 1:109268161-109268183 GCCAGCAGGGAGCTCCTTGTAGG - Intronic
914243973 1:145872452-145872474 GGAGCCAGGCACCTCCTTAAAGG - Exonic
914991239 1:152501290-152501312 TGCCCCAGGCAGCTGCATGAGGG - Intergenic
916183285 1:162106237-162106259 GGCTCCGTGCAGCTCCTGGATGG + Intronic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
918081651 1:181212371-181212393 GGCAGCAGGCAGCTCCTTGGAGG - Intergenic
918927642 1:190809063-190809085 GGTGCCAGGCAGCCCCATGAAGG - Intergenic
919704058 1:200659523-200659545 GGCACCAGGAAGGACCTTGTAGG + Intronic
920283043 1:204858593-204858615 GGCAACAGGCAGCTCCAGCAGGG + Intronic
920337445 1:205254674-205254696 GGCACCTGGCAGCTCCCTAATGG - Intronic
922593144 1:226793999-226794021 GAAATCATGCAGCTCCTTGAAGG + Intergenic
924820989 1:247490580-247490602 CGTACCAGGCAACTCCTTAATGG - Intergenic
1064143239 10:12807543-12807565 GGCTCCAGGCAGTTCTTTGAAGG - Intronic
1064267355 10:13835874-13835896 GGCACCAGGGACCTGTTTGAAGG - Intronic
1064751045 10:18529377-18529399 GGCTACACCCAGCTCCTTGAGGG - Intronic
1067238158 10:44468886-44468908 TGCTCCAGGCAGCTCCCAGATGG - Intergenic
1067945621 10:50686457-50686479 GGCTCCATGCAGGACCTTGAGGG - Intergenic
1069958876 10:72068123-72068145 GCCACCTGGCACCTCCTTCAGGG - Intronic
1070867134 10:79713330-79713352 GGCTCCATGCAGGACCTTGAGGG - Intronic
1070880924 10:79851451-79851473 GGCTCCATGCAGGACCTTGAGGG - Intergenic
1071315258 10:84389389-84389411 GTCTCCTGGCAGTTCCTTGAGGG + Intronic
1071634049 10:87235554-87235576 GGCTCCATGCAGGACCTTGAGGG - Intronic
1071647495 10:87367771-87367793 GGCTCCATGCAGGACCTTGAGGG - Intronic
1072233308 10:93431471-93431493 GTCACCAGTCAGGTCCTTCAGGG + Exonic
1072621152 10:97080298-97080320 GGTAGCAGGGAGCTCCTTGCAGG - Intronic
1075153914 10:119958464-119958486 GGCTCCAGGCAGTTTCCTGAGGG - Intergenic
1076415186 10:130281497-130281519 TGCATCAGCCACCTCCTTGAGGG + Intergenic
1076889595 10:133277115-133277137 GGCGCCAGGCAGGTCCTGGAGGG + Intergenic
1079089604 11:17471331-17471353 GGCACCAGGCTGGACTTTGAAGG + Intronic
1080640857 11:34157532-34157554 GGCAGGAGGCAGGTCCTAGAGGG - Intronic
1082810788 11:57477638-57477660 GCCACCAGGAAGCTCTTTGATGG - Intergenic
1084598011 11:70128689-70128711 GGCAGCAGGCGGCTCCATGCTGG - Intronic
1086970534 11:93075956-93075978 GGCAGCAGGGAGCTGCTAGATGG - Intergenic
1088417572 11:109606471-109606493 TGCAAAAGGCAGCTCCCTGAAGG - Intergenic
1088585206 11:111355196-111355218 GGCACCAGGCAGCAGCAGGAAGG - Intronic
1090206788 11:124888961-124888983 GGGACCAGGCAGGACCTTCAGGG + Intronic
1094503242 12:31038570-31038592 GCCACCTGGAAGCTCCTTGGAGG - Intergenic
1096608747 12:52787356-52787378 GGCTCCATGCAGCTTCTTAAAGG - Intergenic
1098085320 12:66836300-66836322 GGAAGCAGGCATCTTCTTGAGGG - Intergenic
1101229593 12:102726427-102726449 GGAACCAGTGAGCTACTTGATGG + Intergenic
1101522723 12:105499638-105499660 AGCCCCAGGCAGGTCCTTCAGGG + Intergenic
1101568797 12:105934459-105934481 GGCACCAGGCTGGAGCTTGAAGG + Intergenic
1102028250 12:109725632-109725654 GGCACCAGGCAGCCCATTCCCGG + Intronic
1104018425 12:124975722-124975744 GACACCAGGCAGCCGCTAGAAGG + Intronic
1104634256 12:130427762-130427784 GTCAGCAGGGAGCTCCTTAAAGG - Intronic
1106051349 13:26192733-26192755 GGCAGGATTCAGCTCCTTGAGGG - Intronic
1108483889 13:50905676-50905698 GGAACCAGTCAGTTCCTTGAGGG - Intergenic
1110425194 13:75359042-75359064 GGCAAGATCCAGCTCCTTGAAGG + Intronic
1112477720 13:99747461-99747483 GGCACCCGGTAGCTCCTTTGAGG - Intronic
1113778274 13:112961396-112961418 GGAACCAGGCATCTCCTCGCAGG - Intronic
1113983541 13:114295910-114295932 GGCCCCAGGCAGCTTCAGGATGG + Intronic
1114589089 14:23843166-23843188 TGAACCAAGCAGCTCTTTGATGG - Intergenic
1116608941 14:47040831-47040853 CTGACCAGGCAGCTCCTTAAGGG + Intronic
1116991806 14:51285173-51285195 ATCACCTGGAAGCTCCTTGAGGG + Intergenic
1117345208 14:54825293-54825315 GGCACCATCCAACTCATTGAGGG - Intergenic
1119839900 14:77784350-77784372 GGCCCCAGGCAAGTCCCTGATGG - Intergenic
1122576614 14:102746924-102746946 GGCCCCAGGCAGCTGCCTGCTGG + Intergenic
1122599047 14:102912275-102912297 GGCCCCATGCAGTGCCTTGAAGG - Intergenic
1122986112 14:105212450-105212472 GGCACCAGGCAGCTCCTTGAGGG - Intronic
1127282819 15:57506263-57506285 GCCAGCCAGCAGCTCCTTGAAGG + Intronic
1127328613 15:57918063-57918085 GTCACCAGGAAGCTGCTTGTGGG + Intergenic
1128555646 15:68629977-68629999 GGCATCAGGCAACTCCTCCAGGG - Intronic
1129190631 15:73935563-73935585 GGCACCAGGCAGGGCCTGCAAGG + Intronic
1130994318 15:88895460-88895482 GTCCCCAGGCAGCTCCTCGACGG + Exonic
1133126773 16:3652317-3652339 TGCACCAGGCAGTTTCTTGGTGG + Intronic
1133293455 16:4737744-4737766 GGCAGCAGGCAGAGCCCTGAGGG - Intronic
1134544716 16:15098977-15098999 GGCACCAAGAAGCTTTTTGAAGG + Intronic
1135755564 16:25094650-25094672 AGCATCAGGCAGCTCTGTGACGG + Intergenic
1135843199 16:25895083-25895105 GGTTCCAGGCAGTTCCTAGAGGG - Intronic
1139210347 16:65071080-65071102 GGCACCAGGGAGTTCCTCAAAGG - Intronic
1139839887 16:69869840-69869862 GTCAACAGGAAGCTCCTTGAGGG - Intronic
1142118458 16:88373580-88373602 GGCACCAGAAAGCCTCTTGAGGG - Intergenic
1142469997 17:157966-157988 GGCTCCAGGTAGCACCTTCAGGG - Intronic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1142640109 17:1280651-1280673 ATCGCCAGGCAGCTCCCTGAGGG - Intronic
1143585093 17:7846959-7846981 GGCCCCAGGCATCTCCATGCAGG - Exonic
1144572519 17:16408294-16408316 GGGACCAGACACCTCCTGGAGGG - Intergenic
1146531501 17:33611150-33611172 GGGACCAGGCAGCACCAGGAGGG - Intronic
1147456627 17:40542103-40542125 GGCCCCAGCCAACACCTTGATGG - Intergenic
1152337396 17:79706550-79706572 GGCCCCAGGCAGCCCCTCCAGGG + Intergenic
1152541176 17:80976701-80976723 GTCTCCTGGCAGTTCCTTGAGGG - Intergenic
1152695892 17:81794923-81794945 AGCACCAGGTCACTCCTTGATGG - Intergenic
1153698531 18:7668630-7668652 GGCAGGAGGCAGCTGCATGAGGG - Intronic
1153959146 18:10125452-10125474 GACACCAGGAGGCTCCTGGAAGG - Intergenic
1154982365 18:21513813-21513835 GGAACCTGGCAGCACCTGGAAGG - Exonic
1155929386 18:31689786-31689808 GGTCCCAGGCAGCCCCCTGAAGG + Intergenic
1156154341 18:34283712-34283734 GGAACCAGGCAGGTCCTGGCAGG - Intergenic
1156577433 18:38334297-38334319 GGCACCAGGCACCACTTTGATGG - Intergenic
1156703149 18:39848729-39848751 AGCACCAGGCAGCTCTTGGAGGG - Intergenic
1157145697 18:45160039-45160061 GGGACAGGCCAGCTCCTTGACGG - Intergenic
1157848753 18:51028547-51028569 GGCACCATTCAGTTCCTTGCAGG - Intronic
1158288586 18:55913184-55913206 GGCACCAGACAGCTGAGTGAAGG + Intergenic
1158947457 18:62459430-62459452 GGAACCCAGCAGCTCCTTGGTGG + Intergenic
1160436522 18:78856441-78856463 GGCTGCAGGTGGCTCCTTGAGGG - Intergenic
1160787466 19:907676-907698 AGGACCAGGCAGGTCCTTGTGGG - Intronic
1160824835 19:1074714-1074736 GGCACCACGCACCTGCATGAAGG - Exonic
1160922190 19:1526243-1526265 CGCACCTGGCACCACCTTGAGGG - Intronic
1161200231 19:3010541-3010563 GCCACCTGGGAGTTCCTTGAGGG + Intronic
1162094416 19:8302200-8302222 GGCCCCAGGCAGCTCCCAGGGGG - Exonic
1162565798 19:11445440-11445462 GTCATCATCCAGCTCCTTGAAGG - Exonic
1163263200 19:16203736-16203758 GGCAGCAGGGAGCTCCAGGAGGG - Intronic
1165074454 19:33273213-33273235 GGCAGGAGGCAGCTGTTTGAGGG + Intergenic
1166851531 19:45763749-45763771 GGCAGGTGGCAGCTCCTTGAAGG - Intronic
1167793491 19:51694529-51694551 GGCAGCAGCCAGCTCCTGCAGGG - Intergenic
925234736 2:2267751-2267773 GGATCCAGGCACCTCCTTGCAGG - Intronic
927430444 2:23022517-23022539 GTCACCAGGGACCTCTTTGAGGG - Intergenic
927707414 2:25304966-25304988 GGCAACGGTCAGCTCCTTGAGGG + Intronic
930100523 2:47599616-47599638 TGTGCCAGGCAGCTCCTGGAGGG + Intergenic
932958791 2:76387853-76387875 GGCAACATTCAGTTCCTTGAAGG + Intergenic
934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG + Intergenic
935500463 2:103831758-103831780 GGCTCCATGTAGCTCCCTGATGG + Intergenic
937335222 2:121058430-121058452 GGCAGGAGGCAGCCCCTGGAGGG + Intergenic
937411981 2:121684623-121684645 GGCTCTTGTCAGCTCCTTGAAGG + Intergenic
937441797 2:121921690-121921712 TGCACCAGGAAGCTCCTTCAGGG - Intergenic
938763647 2:134446085-134446107 GACACCAGGCAGCTCCTCAAGGG - Intronic
938950384 2:136249592-136249614 GGCACCAGGCAGTTACTTTGTGG - Intergenic
939701774 2:145401067-145401089 AGCACAAAGCAGCTCCTTGAGGG + Intergenic
941678618 2:168371276-168371298 AGCACCAAACAGCTCCTTGGGGG + Intergenic
942635599 2:178001327-178001349 GGCAACTGTCTGCTCCTTGATGG - Intronic
943385755 2:187202254-187202276 GTTATCAGCCAGCTCCTTGATGG - Intergenic
944924937 2:204454980-204455002 GGCACAAAGCAGCTACTTTATGG - Intergenic
945055731 2:205867237-205867259 GGCACCTGGTAGCTCTTTGCTGG - Intergenic
947463412 2:230322176-230322198 GGAACCAGGCAGCTCCATGTTGG - Intergenic
947472313 2:230411193-230411215 GGAACCAGGCAGCTCCATGTTGG - Intergenic
947943234 2:234076698-234076720 GGCCCCAGGCAGGTCTATGAAGG - Intronic
948438449 2:237969381-237969403 GGCCACATGCAGCTCCCTGAAGG - Intronic
948878190 2:240841296-240841318 GGCCACAGGCAGATCCTGGAAGG - Intergenic
948920887 2:241065382-241065404 GCCGCCAGGCAGATGCTTGATGG + Exonic
949026331 2:241768069-241768091 GGGACCAGGCACCTGGTTGAAGG + Exonic
1172278021 20:33691319-33691341 GGTACCAGTCAGTTCCTTGGCGG - Intergenic
1172913626 20:38428217-38428239 CGCCCCAGGCAGCTCCCTGCAGG + Intergenic
1173620154 20:44430282-44430304 GGCACCAGGCAGGGTCTAGAAGG + Exonic
1173714189 20:45187907-45187929 GGCAACAAGGTGCTCCTTGAAGG - Intergenic
1174313155 20:49675132-49675154 GCCACCAGGCTGCTCGTGGAAGG - Intronic
1175270750 20:57732232-57732254 GGAACCAGGCAGCTCGTGGAAGG - Intergenic
1175415531 20:58798268-58798290 GGCAGCCGGCAGCTCCTCCATGG + Intergenic
1175790699 20:61738331-61738353 GGCACCAGGCAGTCCCGTGTCGG + Intronic
1175941589 20:62539852-62539874 GGCTCCAGCCAGCTCCGGGACGG - Intergenic
1181159029 22:20945763-20945785 GGACCCATGCAGCTCCGTGAGGG + Intronic
1183513211 22:38247969-38247991 GGCAGCAGGAGGCTCCCTGAGGG + Exonic
1183733379 22:39630529-39630551 GGCACAAAGCAGTCCCTTGAAGG - Intronic
1183745492 22:39689281-39689303 GGCACCAGGCAGCCCCTTAAAGG + Exonic
1184047994 22:41983860-41983882 CACACTAAGCAGCTCCTTGAGGG + Intronic
1184262756 22:43328806-43328828 CACACCAGGCACCACCTTGATGG + Intronic
949487359 3:4552796-4552818 GCCCCCAGGCAGCTTCTAGATGG - Intronic
950053246 3:10007742-10007764 CCCACAAGGAAGCTCCTTGATGG - Intronic
950304899 3:11910058-11910080 CCCACAAGGCAGCTCCCTGATGG - Intergenic
950401890 3:12775380-12775402 GGGACCAGGCTGCTCCTTCTGGG - Intergenic
950544475 3:13630371-13630393 GCCACCAGGCTGCTCAGTGAGGG + Intronic
951689303 3:25379036-25379058 GGCAACAGCCAGCTTCTTGCAGG + Intronic
953371544 3:42392774-42392796 GGCATCAGAGAGCTGCTTGAGGG + Intergenic
953480504 3:43247512-43247534 GGCTCCTGGCAGCTCTTTGGGGG + Intergenic
953917676 3:46930939-46930961 TGCACCAGGCAGCTCCAGGAGGG + Intronic
954918462 3:54168660-54168682 GGGACCAGGCCACTCCTTTAGGG + Intronic
955393822 3:58540596-58540618 GGCACCTGACAGCTCCTGGGAGG - Intergenic
957445200 3:80307801-80307823 GGCACCTGTCAGCTACTTAAAGG + Intergenic
959020626 3:101184254-101184276 TAAACCAGGCAGCTCCTTGTTGG - Intergenic
959397383 3:105857800-105857822 CCCACTAGGCAGCTGCTTGAGGG - Intronic
959999527 3:112716042-112716064 GGCCACAGGTAGCTTCTTGAGGG + Intergenic
961628614 3:128280613-128280635 GGTGCCAGGGAGCTCCTGGAGGG - Intronic
962007134 3:131360821-131360843 AGCAGGAGGCAGCTCCTTGAGGG - Intergenic
962009498 3:131380537-131380559 AGCAGGAGGCAGCTCCTTGAGGG - Intergenic
963416367 3:145000518-145000540 TTCACTAGGCAGCTCCCTGAAGG + Intergenic
968525542 4:1054924-1054946 GGGAACAGTCAGCTCCTGGAGGG + Intergenic
968525571 4:1055050-1055072 GGGAACAGTCAGCTCCTGGAGGG + Intergenic
968549723 4:1215979-1216001 GGCTCCACGCACCTGCTTGACGG + Exonic
968621190 4:1604159-1604181 TGCACCAGGCAGCCCCTTCCCGG - Intergenic
968831050 4:2933227-2933249 GGTGCCAGGCAGCCCCATGATGG - Intronic
971353232 4:25871340-25871362 GGGCCCAGGCAACTCTTTGAAGG + Intronic
972768354 4:42172421-42172443 GAAACAAGGCTGCTCCTTGAGGG - Intergenic
977538972 4:98291901-98291923 GACACCTGGCAGTTCCTTAAAGG - Intronic
979357825 4:119726237-119726259 GGAACCAGGAAGCACGTTGAAGG - Intergenic
982113211 4:152074985-152075007 GGCACCGGGCAGCTCCGTGGAGG - Intergenic
984417896 4:179483911-179483933 GGCACAAGGCTGCCCATTGATGG + Intergenic
986424833 5:7620965-7620987 GACACCAGGCAGCACCCTGCAGG - Intronic
990540904 5:56771606-56771628 CGCCCCAGGCAGCTCTGTGAAGG + Intergenic
992625240 5:78630903-78630925 GCCACCCGGCAGCTCCTGAAAGG + Intronic
992705921 5:79392233-79392255 AGCCCCAGGCAGGTCCTTCAGGG + Intronic
992943136 5:81782765-81782787 AGCTCCAGGCAGGTCCTTCAGGG - Intergenic
993000194 5:82373301-82373323 GGCACAGGGCAGCACCGTGAAGG + Intronic
995271088 5:110220310-110220332 TGCACCATGCAGCTTCTTCATGG - Intergenic
995408337 5:111827462-111827484 GGAACCAGGCTGCTCCTCCAAGG + Intronic
995532797 5:113107825-113107847 GGCAACAGGCTGCTTCCTGAGGG + Intronic
996888652 5:128389810-128389832 GGCACTTGGCAGCCCCATGAAGG + Intronic
997589391 5:135063654-135063676 AGCCCCAGGCAGCTCCTAGAGGG + Intronic
997857190 5:137382994-137383016 AGCACCAAGCAGCCCCCTGAGGG + Intronic
999372193 5:151062690-151062712 TGCTGCAGGGAGCTCCTTGAAGG + Intronic
999504363 5:152179824-152179846 GGCCTTAGGCAGCTCCTTCATGG + Intergenic
1001474733 5:172042427-172042449 GGGACGCGGCAACTCCTTGAAGG + Exonic
1001664391 5:173420626-173420648 GGGCCCAAGCAGCTCCTTTAGGG + Intergenic
1002056814 5:176602791-176602813 AGCACCGGGCAGCTACTAGAAGG + Intronic
1002316962 5:178349756-178349778 GGCCCCAGGCTCCTCCTTGCAGG + Intronic
1002418940 5:179135516-179135538 GGCACTGGGCAGCTTCTTGCTGG - Intronic
1002494655 5:179603513-179603535 ACCCCCAGGGAGCTCCTTGAGGG + Intronic
1002776248 6:330070-330092 GGCACCCGGCACCTCCCTCATGG + Intronic
1003378844 6:5604075-5604097 GGCTCCTAGCAGCTCCTTAAAGG + Intronic
1004202126 6:13558674-13558696 AGCACCTGGCAGCACCTGGAAGG - Intergenic
1006177129 6:32129084-32129106 AGCATCGGGCAGCTCCTTCAGGG + Exonic
1006437054 6:34031147-34031169 GGCACCAGGAAGGTCCTAAAGGG + Intronic
1006804498 6:36779334-36779356 GGCACGTGGCAACCCCTTGATGG + Intronic
1006822347 6:36907426-36907448 GGCACCAGGAAGCTCCCTGATGG + Intronic
1006835741 6:36997850-36997872 GGAACTCGGCAGCTCCTTGATGG + Intergenic
1009877989 6:69530216-69530238 GGTACAAGGCAACTCCATGATGG + Intergenic
1014303444 6:119712004-119712026 GGTACCAGCCAGCTCCCTGCTGG - Intergenic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1021612875 7:22475210-22475232 GGCACCTGGCATCTCCCTGCTGG + Intronic
1022763365 7:33381356-33381378 GTCTCCTGGGAGCTCCTTGAGGG + Intronic
1022765022 7:33402191-33402213 GGCAACAGGGATCCCCTTGAAGG - Intronic
1024005066 7:45219393-45219415 GGCACCGTGCAGCTCCTTGTGGG + Intergenic
1024094651 7:45974208-45974230 GGCAGCGGGCAGCTGCGTGAGGG - Intergenic
1037711804 8:21360996-21361018 TCCAGGAGGCAGCTCCTTGAGGG - Intergenic
1038890465 8:31716189-31716211 AGCATCAGGCAGCTGCTTTATGG + Intronic
1039546502 8:38414658-38414680 GGCCCCAGGCAGGGCCATGAGGG + Intronic
1040383964 8:46900747-46900769 GCCACCTGGCAGATCCTGGATGG + Intergenic
1043909509 8:85845088-85845110 AGCATCAGGCAGGTCCTTCATGG + Intergenic
1044692290 8:94893638-94893660 TGCACCAGGCAGTTCCAAGAGGG + Intronic
1046663118 8:116970334-116970356 AGCCCCAGGCAGGTCCTTCAGGG - Intronic
1047254598 8:123206222-123206244 GGCCCCAGGCCTCTCCTTGAGGG + Intronic
1049359661 8:142206279-142206301 GGGACCCGGCAGCTCCTGGCCGG + Intergenic
1049486489 8:142866436-142866458 GTCTCCAGGCAGCTCCCTGGAGG + Intronic
1049679428 8:143911100-143911122 GGCACATGGCAGCCCCTGGAGGG + Intergenic
1049780702 8:144427528-144427550 GGCGGCAGGCAGCTGTTTGATGG + Intronic
1053036509 9:34831267-34831289 GGCACCAGGTAGATCCTGGGAGG + Intergenic
1056453345 9:86737825-86737847 GGCACCACCCACCTCCTTGCTGG + Intergenic
1057263699 9:93600327-93600349 GGGAAGAGGCAGCTCCTGGAGGG + Intronic
1057293440 9:93821456-93821478 GGGACCAGGCAGGTCCTGGTAGG - Intergenic
1057392232 9:94649546-94649568 GCCACCAGGCAGGTCTCTGAAGG + Intergenic
1058474103 9:105313528-105313550 GGCAGCATACAGTTCCTTGAGGG + Intronic
1058873924 9:109225672-109225694 GGTAGCAGTGAGCTCCTTGAAGG - Intronic
1058974897 9:110116691-110116713 GGGAACAGGCAGCTCTTGGAAGG + Intronic
1059510103 9:114837007-114837029 GGCTCCATGCAGCTCCTGGGTGG + Intergenic
1059665856 9:116446032-116446054 GGGACCAGGCAGTGCCTGGAGGG + Intronic
1060933882 9:127505032-127505054 GGCAGCAGGCAGCAGCTTCAAGG - Intergenic
1189363442 X:40370513-40370535 GGTTACAGGCAGCTCCCTGAAGG - Intergenic
1190708587 X:53049616-53049638 GGTACCAAGGAGCCCCTTGATGG - Intronic
1190735989 X:53256307-53256329 GGGACCAGGCAGAGCCTTGAGGG - Intronic
1192190336 X:68987536-68987558 CTCACCTGGAAGCTCCTTGAGGG + Intergenic
1193738279 X:85186141-85186163 GGCACCAGGCAGAGTCCTGAGGG - Intergenic
1194193470 X:90865126-90865148 GGCAGCAGGCAGCTGCTTTGAGG - Intergenic
1194240132 X:91435223-91435245 GGAACCAGCCAGCTGCTTGGTGG + Intronic
1194526102 X:94978740-94978762 GGCACCAGTCAGTCCCTTGGTGG + Intergenic
1196611773 X:117723285-117723307 GACAGCAGGAAGCTCCTTGAGGG - Intergenic
1200072556 X:153536354-153536376 GGCCCCTCGCAGCTCCATGAGGG - Exonic
1200540081 Y:4447513-4447535 GGCAGCAGGCAGCTGCTTTGAGG - Intergenic
1200818194 Y:7555222-7555244 GGCAGCAGCCAGCTCTTTGGGGG + Intergenic