ID: 1122987017

View in Genome Browser
Species Human (GRCh38)
Location 14:105217188-105217210
Sequence CAGAGCAGGCACAGGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 495}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122987009_1122987017 10 Left 1122987009 14:105217155-105217177 CCTCAGCAGAGACGGCAATGCAG 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG 0: 1
1: 0
2: 8
3: 51
4: 495
1122987007_1122987017 17 Left 1122987007 14:105217148-105217170 CCCATCACCTCAGCAGAGACGGC 0: 1
1: 0
2: 1
3: 6
4: 109
Right 1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG 0: 1
1: 0
2: 8
3: 51
4: 495
1122987008_1122987017 16 Left 1122987008 14:105217149-105217171 CCATCACCTCAGCAGAGACGGCA 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG 0: 1
1: 0
2: 8
3: 51
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122987017 Original CRISPR CAGAGCAGGCACAGGGCGGC AGG Intronic
900266532 1:1759971-1759993 CACAGCAAGCACAGGATGGCGGG + Intronic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900590699 1:3458255-3458277 CAGGGCATGCACAGGGCAGAGGG - Intronic
900604112 1:3516227-3516249 CTGAGCTGGCGCAGGGAGGCGGG + Intronic
900699176 1:4033384-4033406 CAGCGCTGGCACAGAGCGTCTGG + Intergenic
901130436 1:6959426-6959448 CAGAGCAGGCCCAGGGCGACTGG + Intronic
901632084 1:10653012-10653034 AAGAGCAGGCCCAGGGCCCCTGG - Intronic
901802869 1:11719365-11719387 CAGAGAAGACTCAGGGCGGTCGG - Intronic
902372425 1:16014877-16014899 CCCAGCAGGCGCAGGACGGCAGG + Exonic
903792969 1:25906753-25906775 CGGAGCAGGCGGAGGGCGGGGGG + Intronic
903982233 1:27197475-27197497 CAGACCAGACACAGGGCAGGAGG + Intergenic
904531208 1:31170937-31170959 CTGAGCAGGCCCAGGCCAGCTGG - Intergenic
904617303 1:31756713-31756735 CAGAGCAGGCACTGGGGGCGGGG + Exonic
904642731 1:31942593-31942615 CAGATCAGGAACTGGGCTGCAGG + Intronic
905025467 1:34846521-34846543 CAGAGCAGGGACAGTGAGACAGG + Intronic
905368520 1:37469637-37469659 GAGAGCAGGAACAGAGAGGCTGG - Intergenic
905643799 1:39610327-39610349 CTGGGGAGGCGCAGGGCGGCTGG - Intergenic
905869069 1:41392605-41392627 CAGAGCAGGCAAAGACCGACTGG - Intergenic
905888467 1:41504605-41504627 CTGAGCAGACAGAGGGCAGCCGG + Intergenic
906056886 1:42924633-42924655 CAGCGCAGGCGCAGGGAAGCCGG - Intergenic
907756242 1:57313505-57313527 CATAGCAGGCACAGTGCCTCAGG - Intronic
908071259 1:60462897-60462919 CAGAGGAGCCACAGAGGGGCAGG + Intergenic
908887365 1:68804861-68804883 CACAGGAGGAACAGGGGGGCAGG + Intergenic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
911208618 1:95117551-95117573 CCGAGCCGGGAGAGGGCGGCGGG - Exonic
911235702 1:95410063-95410085 CAGAGCAGGTACAGCAGGGCAGG - Intergenic
912933015 1:113981166-113981188 CTGGGTAGGCACAGGGCAGCTGG + Exonic
913700829 1:121373020-121373042 TAGAGCAGGCACTAGGTGGCTGG + Intronic
914041379 1:144053487-144053509 TAGAGCAGGCACTAGGTGGCTGG + Intergenic
914136706 1:144907003-144907025 TAGAGCAGGCACTAGGTGGCTGG - Intronic
914197343 1:145454439-145454461 GAGAGCGGGCCCGGGGCGGCGGG - Intergenic
915537889 1:156548519-156548541 CAGAGCAGGCAAGGGGTGGCTGG + Intronic
916171444 1:162004138-162004160 CAGAGCAGGAAAGGGGCGCCTGG + Intronic
916720809 1:167483703-167483725 CAGAGCAGGCACTGCCCTGCAGG - Intronic
917494505 1:175527937-175527959 CAGTGCAGGCACAGGCAGGCTGG + Intronic
917794766 1:178525305-178525327 CAGAGTAGGCATGGGGAGGCAGG - Intronic
918983791 1:191596674-191596696 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
920430807 1:205917697-205917719 CAAAGCAGGCAAAGTGAGGCTGG - Intronic
920488247 1:206391756-206391778 TAGAGCAGGCACTAGGTGGCTGG + Intronic
921015161 1:211183061-211183083 CAGAGCAATCCCATGGCGGCAGG + Intergenic
921365247 1:214367628-214367650 CAGAGCAGGCACAAGGCTACAGG + Intronic
922087782 1:222367742-222367764 GAGAGCAGGAGCAGGGCGGGTGG - Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922676926 1:227559070-227559092 CTGAGCCAGAACAGGGCGGCAGG - Intergenic
922987888 1:229880476-229880498 CTGAGCAGGCAGAGGTCGGGTGG + Intergenic
923576167 1:235160952-235160974 CAGAGGTGGCACCGGTCGGCTGG - Exonic
924708949 1:246518844-246518866 CAAAGCAGACCCAGGGTGGCTGG - Intergenic
1063444365 10:6100337-6100359 CACAGCAGGCACACTGCGTCAGG - Intronic
1064031650 10:11886789-11886811 CAGAGCTGGCACAGGGTCACAGG + Intergenic
1064232192 10:13538766-13538788 TAGAGCAGCCCCAGGGCTGCTGG - Intergenic
1064561026 10:16595660-16595682 CAGAGGAGGCACAGCCGGGCTGG - Intronic
1064712323 10:18140421-18140443 GAGAGCGGGCGCAGCGCGGCGGG - Intergenic
1065970144 10:30799552-30799574 CACTGCAGGCACAGGGAGGCAGG - Intergenic
1066249335 10:33617925-33617947 CACAGAGGGGACAGGGCGGCGGG - Intergenic
1067710639 10:48648758-48648780 CAGAGCAGGCGCAGCGGGGTGGG + Intronic
1067752503 10:48981445-48981467 CAGAGCAGTCACTGCGGGGCTGG - Exonic
1068375260 10:56170067-56170089 GAAAGCAGGCACAAGGCAGCAGG + Intergenic
1069082554 10:64103854-64103876 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1069637037 10:69931200-69931222 CAGAGCAGACCCAGAGTGGCAGG + Intronic
1069832429 10:71289468-71289490 CAGAGCTGACGCAGGGCAGCGGG - Intronic
1070736959 10:78869707-78869729 CATGGCCAGCACAGGGCGGCCGG + Intergenic
1070797933 10:79227944-79227966 GAGAGCTGGCAGAGGGAGGCTGG + Intronic
1071345114 10:84685042-84685064 GAGAGCAGCGACAGGCCGGCTGG - Intergenic
1073057268 10:100710512-100710534 CCGGGCAGGCGCAGGGCGGGGGG + Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075664438 10:124220693-124220715 CAGGGCTGGCAGAGGGCGGAAGG - Intergenic
1075726320 10:124612703-124612725 CAGAGGAGGCACCGGGCTCCTGG - Intronic
1075888882 10:125928178-125928200 CAGAGCAGCCCGAGGGCTGCTGG + Intronic
1076698590 10:132258607-132258629 CCGAACAGGAACAGGGCGGCGGG + Intronic
1076784463 10:132742954-132742976 CGGGGCAGGCGCAGGCCGGCTGG - Intronic
1076816755 10:132918855-132918877 CAGAACGGGCACAGGGGGTCTGG - Intronic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1077107935 11:849943-849965 CGGAGCAGGCGCCGGCCGGCGGG + Intronic
1077301677 11:1850153-1850175 CACGGCAGCCACAGGGCAGCAGG - Intergenic
1077434599 11:2532728-2532750 GACAGCAGGCACAGGGCTGTGGG + Intronic
1077478116 11:2800496-2800518 CAGAGCAGGCAAAGTGGGGAGGG - Intronic
1081680338 11:44998179-44998201 CAGACCAGGAACTGGGAGGCAGG - Intergenic
1083635971 11:64121184-64121206 CAGAGCAGGCCCAGGCAGGCAGG + Intronic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083680442 11:64349297-64349319 CAGAGCAGGCTCAGGGCAAGGGG - Intronic
1083852228 11:65375086-65375108 CAGAGCAGGAAAATGGGGGCTGG + Intergenic
1084148864 11:67278836-67278858 CAGAGCAGGCGCAGGGCCCTGGG + Intronic
1084196256 11:67524780-67524802 CAGAGGGGGCACAGAGGGGCAGG - Intergenic
1084403830 11:68959908-68959930 CAGACCAGGAACAGGGCAGCTGG - Intergenic
1084433349 11:69123608-69123630 CAGAGCTGGCATTCGGCGGCAGG - Intergenic
1084740294 11:71135051-71135073 CAGAGAAGGCTGAGGGCTGCGGG - Intronic
1085374684 11:76048924-76048946 CCAAGCAGGCATAGGGCAGCAGG + Intronic
1085391186 11:76183120-76183142 CAGAGCCGCCTCAGAGCGGCTGG + Intergenic
1085953300 11:81359377-81359399 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1086502859 11:87471367-87471389 CAGACCAGGCACAGTGGGGAGGG + Intergenic
1087531359 11:99386342-99386364 CAGAGCAGCCCGAGGGCTGCGGG + Intronic
1088110873 11:106259909-106259931 CAAAGCAGCCAAAGGGAGGCAGG + Intergenic
1088885230 11:114000965-114000987 CAGATCAGGCACAGGGTGAATGG - Intergenic
1089008024 11:115108777-115108799 CAGAGCAGACACAGGGTAGCGGG - Intergenic
1089492853 11:118894577-118894599 AAGAGCTGGCACAGGGAGGCAGG - Exonic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090647442 11:128777195-128777217 CAGTTCAGGCTCAGGGCCGCTGG + Intronic
1091301291 11:134509791-134509813 CAAAGAAGGCACAATGCGGCTGG - Intergenic
1091346330 11:134856753-134856775 CAGTGCAGGCAGAGCGTGGCTGG + Intergenic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1092081940 12:5723601-5723623 CAGAGAAGGGGCAGGGCGGGTGG + Intronic
1092853395 12:12650975-12650997 CAGAGCAGCCCAAGGGCTGCTGG - Intergenic
1094679773 12:32657925-32657947 CAGAGCAGGATAAGGGGGGCTGG - Intergenic
1095159013 12:38893549-38893571 CAGAGCAGCACCAGGGTGGCTGG - Intronic
1095789221 12:46146016-46146038 CACAGCAGTCACAGGGTGGTAGG - Intergenic
1095978894 12:47959103-47959125 CAGGGCAGCCACAGGGCTGCTGG - Intergenic
1096531680 12:52246572-52246594 AAGAGGAGACACAGGGCCGCAGG + Intronic
1096747632 12:53738893-53738915 GAGAGCAGGCAGAGGGCAGGAGG + Intergenic
1096770188 12:53930721-53930743 CAGAGCAGGTCCAGTGGGGCAGG - Intergenic
1098535285 12:71587279-71587301 CAGAGCACCCACAGGGCACCTGG + Intergenic
1099033652 12:77559751-77559773 CAGAGCAGGCACTGGGAGAGAGG - Intergenic
1099370916 12:81828957-81828979 CAGAGCAGCCCGAGGGCTGCTGG + Intergenic
1099738455 12:86600903-86600925 CAGAGCAGGCACTGGGAGCAGGG - Intronic
1100819655 12:98419605-98419627 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1100820351 12:98423655-98423677 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101396947 12:104356723-104356745 CAGAGAAGGCACACGGGGACAGG + Intergenic
1101438065 12:104680823-104680845 CACAGCAGGAACAGGGGGGCGGG - Intronic
1102339207 12:112108594-112108616 CCGGGCAGGCGCAGGGGGGCGGG - Intronic
1102518838 12:113466778-113466800 TACACCAGGCACAGGGCGGCAGG + Intronic
1102587199 12:113931714-113931736 CAGAACAGGCAGAGGCCAGCAGG - Intronic
1102695972 12:114799819-114799841 CAGAGCAGGCCCAGGGCACAGGG - Intergenic
1103655426 12:122466739-122466761 CAGAGCAGCCCCAGGGCTGCTGG + Intergenic
1103725592 12:122996014-122996036 CAGGGCAGGTACATGGGGGCAGG - Intronic
1104092125 12:125526077-125526099 CAGAGCAGAGACAGGGTGGGAGG + Intronic
1104358750 12:128112468-128112490 CAGAGCTGGCACAGAGCAGAGGG - Intergenic
1104448216 12:128849864-128849886 CAGAGCAGCCCGAGGGCTGCTGG + Intergenic
1104917252 12:132272094-132272116 CAGAGCAGCCCCAGAGCGGTCGG + Intronic
1105002895 12:132702684-132702706 CAGTCCAGGCACAGGGCAGGTGG + Intronic
1105006403 12:132723561-132723583 CAGAGCAGGCGCAGGTTTGCTGG + Intergenic
1105418308 13:20232018-20232040 CAGAGCCGGCAGAGCGCGGCCGG - Intronic
1106036845 13:26051519-26051541 CAGAGGAGGCTGAGCGCGGCCGG - Intergenic
1106083467 13:26519734-26519756 CAGAGCAGCCACTGGGAGGAAGG - Intergenic
1106454982 13:29919262-29919284 CAGAGCAGGTTCAGGGCAGGAGG + Intergenic
1107019974 13:35741336-35741358 CAGAGCAGTCCGAGGGCTGCTGG + Intergenic
1107104353 13:36627199-36627221 CAGAGAAGCCAAAGGGCAGCAGG + Intergenic
1107779037 13:43879296-43879318 GGGAGCGGGCGCAGGGCGGCAGG - Exonic
1108261278 13:48659113-48659135 CAGAGGAGACACTGGGCAGCAGG + Intronic
1108844686 13:54663172-54663194 CAGAGCAGCCCTAGGGCTGCCGG + Intergenic
1110046591 13:70840870-70840892 CAGAGCAGACTGAGGGCTGCTGG - Intergenic
1110046747 13:70841697-70841719 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1111442917 13:88304301-88304323 CTGAGGATGCACAGGGCAGCAGG - Intergenic
1112911003 13:104483690-104483712 CAGAGCAGACACTGGGGAGCTGG + Intergenic
1113531738 13:111032349-111032371 CTGAGCAAGCACAGGCCTGCTGG + Intergenic
1113674657 13:112198897-112198919 CGGAGCAGCCATGGGGCGGCTGG - Intergenic
1113835405 13:113325588-113325610 CAGAGCAGCCCCCGGGCTGCAGG + Exonic
1114373282 14:22113616-22113638 CAGAGCAGGAAGTGAGCGGCAGG - Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1116159817 14:41253871-41253893 CAGAGCAGGCACTGGGAGTGAGG + Intergenic
1116373194 14:44162388-44162410 CCAAGCAGGCACAGGGCAGCAGG + Intergenic
1118947096 14:70398584-70398606 CAGAGCAGGCACTGGGAGCAGGG + Intronic
1120949779 14:90030269-90030291 CAGAGCAGGCACATCCCGGGAGG - Intronic
1120971733 14:90213593-90213615 CAGGGCAGCCACAAGGCAGCCGG - Intergenic
1121182764 14:91942040-91942062 CTGAGCAGGCTGAGGGCTGCAGG - Intronic
1121246619 14:92465469-92465491 CAGAGCAGCCACAGAGCTTCAGG + Intronic
1121597223 14:95173574-95173596 CAGGGCAGGGACAGGACAGCAGG - Intergenic
1121637184 14:95461822-95461844 CAGAGCAGGGACTGGGAGGCTGG + Intronic
1122051174 14:99061157-99061179 CACAGCAGGAACAGGGCGATTGG - Intergenic
1122310002 14:100788499-100788521 CTGAGCTTGCACAGGGCGGTGGG - Intergenic
1122637896 14:103138794-103138816 CAGCGCGGGGACAGGGCGGGCGG + Intergenic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123068050 14:105628045-105628067 CAGAGCAGCCACAGGGGAGGAGG - Intergenic
1123068074 14:105628124-105628146 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123071979 14:105646458-105646480 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123072025 14:105646666-105646688 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123091640 14:105744734-105744756 CAGAGCAGCCGCAGGTCAGCAGG - Intergenic
1123091936 14:105745801-105745823 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123092030 14:105746193-105746215 CAGAGCAGCCGCAGGTCAGCAGG - Intergenic
1123097393 14:105773005-105773027 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1202869709 14_GL000225v1_random:150470-150492 CAGAGCAGCCCGAGGGCTGCTGG - Intergenic
1123438383 15:20272436-20272458 CAAAGGAGGCGCAGGGCAGCAGG - Intergenic
1123701667 15:22918660-22918682 CACAGCGGGCACAGGGCGTGGGG + Intronic
1123996503 15:25721418-25721440 CACTGCAGGAACAGGGCGGGCGG + Intronic
1124344521 15:28913384-28913406 CGGAGCTGGAACAAGGCGGCAGG - Intronic
1126702060 15:51377405-51377427 CAGAGCAGACAGTGGGCAGCAGG - Intronic
1127902764 15:63353437-63353459 CAGACCTGGCAAAGGGAGGCCGG - Intronic
1128676661 15:69614914-69614936 AAAAGCAGGCACAAGGCTGCAGG - Intergenic
1128787289 15:70407139-70407161 CAGAGCTGTCCCAGGGCAGCGGG - Intergenic
1128865989 15:71115562-71115584 CAGGGCGGGCGCGGGGCGGCTGG + Intronic
1129112520 15:73345865-73345887 CAGAGCGGGTGCAAGGCGGCTGG + Intronic
1129386706 15:75200472-75200494 CAGGGCAGGGACAGGGTCGCCGG + Intronic
1129669078 15:77597171-77597193 CTGAGCAGGGACAGGGTGGGGGG + Intergenic
1130721115 15:86386350-86386372 CAGAGCAGCCCCAGGCCAGCTGG + Intronic
1130888700 15:88115276-88115298 CAAAGCAGGCACAAAGCAGCGGG + Intronic
1130962791 15:88674681-88674703 CAGAGCCTGCAGAGGGGGGCTGG - Intergenic
1130985035 15:88839109-88839131 CAGTGCAGGCGCAGGCAGGCTGG + Intronic
1132679263 16:1133059-1133081 CAGAGCAGGCCCAGGCAGGCTGG + Intergenic
1132752653 16:1465887-1465909 CAGGGCAGGGGCAGGGCAGCGGG + Intronic
1132764290 16:1526515-1526537 CAGTGCAGGCTCAGGCCGGTGGG + Intronic
1132854159 16:2037371-2037393 CGGGGCAGGCACCGGGCGCCTGG - Intronic
1132929980 16:2454133-2454155 AAGGGCAGGCACTGGGTGGCTGG + Intronic
1132982050 16:2743250-2743272 CAGAGCAGGGAAAGTGCTGCTGG + Intergenic
1133025744 16:2988295-2988317 CAGAGAAGGAAAAGGGCTGCGGG - Intergenic
1133028120 16:2997411-2997433 CAGAGCAGGTACTGGGGGGCTGG + Intergenic
1133099416 16:3470218-3470240 CAGTGCAGGCACTGTGGGGCAGG - Intronic
1133561766 16:6957049-6957071 CAGAGCAGCCCAAGGGCTGCTGG + Intronic
1134095200 16:11414372-11414394 GAGAGCAGGCACTGTGTGGCTGG + Exonic
1134698472 16:16244102-16244124 AACCGCAGGCACAGGGCGGGTGG - Intronic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136274283 16:29169383-29169405 CAAGGCAGGCACATGGCGGGGGG - Intergenic
1136637846 16:31537318-31537340 CAGATCAGTTAAAGGGCGGCCGG - Intergenic
1137276510 16:46937798-46937820 CAGAGCAGCCCCAGGGCTGCTGG - Intergenic
1137593340 16:49707174-49707196 CAGAGGTGACACAGGGCGTCGGG - Intronic
1137678335 16:50315714-50315736 CAGACCAGGCACAGAGCTTCTGG - Exonic
1138108888 16:54307588-54307610 TAGAGCAGGTACAGAGAGGCAGG - Intergenic
1138197244 16:55060694-55060716 CAAAGCAGGCACAGGGCAGCAGG - Intergenic
1138248026 16:55481144-55481166 CAGAGCAGGGAATGGGCTGCTGG + Intronic
1138597475 16:58036659-58036681 CAGAGCAGGGACTGGGCTTCAGG + Intronic
1139463709 16:67142613-67142635 CAGAGCAGGCACCGGGAGTGGGG + Intronic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1140281310 16:73557468-73557490 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142663275 17:1446170-1446192 CACAGCAAGCACAGTGTGGCTGG + Intronic
1143041734 17:4043110-4043132 CAGAGCAGGCTCAGGGAGATGGG - Intronic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144676801 17:17167224-17167246 CAGAGCAGGCACAGGCAGCCCGG + Intronic
1144816651 17:18039737-18039759 CAGCGGAGGCACCGGCCGGCGGG - Exonic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145722893 17:27089694-27089716 CAGAGCAGTAAGAGGGTGGCCGG + Intergenic
1146298818 17:31672341-31672363 CTGAGCAGGCAGAGGAGGGCTGG - Intergenic
1147046444 17:37755611-37755633 CAGAGCGGGGACATGGCAGCTGG + Intergenic
1147668446 17:42163388-42163410 CAGAGCAGACAGAGGGGGACTGG + Intronic
1148153566 17:45410359-45410381 CAGTGCTGGCACAGGGCAACAGG + Intronic
1148326595 17:46786635-46786657 CTGAGCACGCACAGGGCATCTGG - Intronic
1149104313 17:52943691-52943713 CAGATCAGCCCCAGGGCTGCTGG + Intergenic
1150833080 17:68541047-68541069 CAGGGCAGGATCAGGGAGGCAGG - Intronic
1151856705 17:76726852-76726874 CAGAACTGGCAACGGGCGGCTGG - Exonic
1151881097 17:76895015-76895037 CACAGCAGGAAGTGGGCGGCAGG + Intronic
1152147843 17:78579805-78579827 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1152223505 17:79082089-79082111 CAGGGGAGGCACTGGGCCGCTGG - Intronic
1152228232 17:79102471-79102493 CAGGGCAGCCAAAGGGTGGCTGG - Intronic
1152468533 17:80478305-80478327 CAGAGCACGCAAGGGGCCGCGGG - Intergenic
1152566259 17:81101737-81101759 CCCAGCAGGCCCAGGCCGGCAGG - Intronic
1152822400 17:82444026-82444048 CAGAGCAGCGACAGTGAGGCCGG - Exonic
1152925762 17:83087073-83087095 CAGAGCAGGCATTCGGCGGTGGG + Intronic
1153347073 18:4038436-4038458 GAGAGCAGCCACAGAGAGGCAGG + Intronic
1153428051 18:4987897-4987919 CAGAGCAGGCACTGGGCGTGGGG + Intergenic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1156183994 18:34640263-34640285 CAGAGGAGGGACAGGCAGGCAGG - Intronic
1156303099 18:35852739-35852761 CAAAGCAGTCACAGTGTGGCAGG - Intergenic
1156449640 18:37259640-37259662 CAGAGCAGGGGCAGGGCAGGAGG - Intronic
1156473963 18:37394262-37394284 CAGAGCAGGGAGAGGGACGCGGG + Intronic
1157616139 18:48988845-48988867 CAGAGCAGGCCCAAGGCTGGGGG + Intergenic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1158626891 18:59079373-59079395 CTGAGCAAGCACAGGGTGGCTGG - Intergenic
1160810673 19:1011662-1011684 CACTGCGGGCACAGGGCGGCGGG + Exonic
1160895402 19:1399939-1399961 CTGGGCAGACACAGGGCGCCTGG + Intronic
1161124021 19:2546014-2546036 CAGAGCGGACACAGGGCATCAGG + Intronic
1161267166 19:3369715-3369737 CAGAGCAGGCGCGGGGAGGCCGG - Intronic
1161697668 19:5778613-5778635 CAGGGCAGGCACAGAGCCCCCGG + Exonic
1161741879 19:6026124-6026146 CAGAGCAGGGACAGGTTGCCAGG + Intronic
1162661699 19:12174396-12174418 CAGAGCAGGCACTGTCAGGCAGG - Intronic
1163290552 19:16376737-16376759 CAGAGTGGCCACAGGGCTGCCGG + Intronic
1163312133 19:16521085-16521107 CAGAGGAGCCACTGGGCTGCAGG - Exonic
1163487665 19:17598235-17598257 CAGAGCAGCCCCAAGGCTGCTGG + Intergenic
1163636757 19:18440610-18440632 GGGAGCTGGCACAGGGCAGCTGG + Intergenic
1163809071 19:19419094-19419116 CAGAGCAGGCACAGACCAGGGGG - Intronic
1164735097 19:30535462-30535484 CAGACCTGGGACAGGGCAGCTGG + Intronic
1165016644 19:32886045-32886067 CAGAGCAGACACAGGACCTCAGG - Intronic
1165333812 19:35155458-35155480 CAGGGCAGGGAAAGGGCTGCAGG + Exonic
1165419535 19:35716101-35716123 CAGAGAAGGCAAAGGAGGGCAGG - Intronic
1165824490 19:38698097-38698119 CAGAGCAGGCACACTGTGGAGGG + Intronic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1166258105 19:41620145-41620167 CAGTGCAGGCTCAGGGCAGGGGG - Intronic
1167100767 19:47403248-47403270 CAGAGAAGGGACGGGGTGGCTGG - Exonic
1168016750 19:53580354-53580376 CACAGCAGGGACAGCGCGGGAGG + Intergenic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
925178032 2:1798516-1798538 CAGAGATGACACAGGGCTGCAGG - Intronic
925474706 2:4200172-4200194 TAGAGCAGGCAGAGGACAGCAGG + Intergenic
925843331 2:8012639-8012661 CAGGGCATGCACAGGGCGCGAGG + Intergenic
925892452 2:8446610-8446632 CAGAGCAGCCCGAGGGCTGCTGG + Intergenic
926126709 2:10276742-10276764 AAGGGGAGGCACAGGGTGGCGGG - Intergenic
926375500 2:12223680-12223702 CAGAGCAGGAACAGGGCCCTGGG - Intergenic
926605055 2:14888965-14888987 CAGCCCAGGCACAGGCCCGCGGG - Intergenic
926768987 2:16351349-16351371 CAGAGGCTGCACAGGGCAGCAGG - Intergenic
927490339 2:23517105-23517127 CACAGCGGGCACAGGGAGACAGG - Intronic
927911485 2:26903008-26903030 CAGAGCAGCTCCAGGGCTGCTGG - Intronic
928437432 2:31264001-31264023 CACAGCAGGCACAGGCAGGCAGG - Intronic
928607175 2:32953659-32953681 CAGAGCAGGCAGGGGGCGGGCGG - Intronic
928693414 2:33824216-33824238 CAGAGAAGGGACAGGGTGCCAGG + Intergenic
930092674 2:47542556-47542578 CAGAACAGGCCCAGGGTTGCTGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
933599961 2:84318887-84318909 GAGAGCAGGCAAAGGGGAGCAGG + Intergenic
933698603 2:85238285-85238307 CAGGGCAGGCAGCGGGAGGCGGG + Intronic
934051589 2:88215638-88215660 AAGACCATGCACTGGGCGGCGGG + Intergenic
934504944 2:94882705-94882727 CAAAGAAGGCACAGGGGAGCAGG + Intergenic
934664856 2:96163233-96163255 CTGAGCAGGCCAAGGGGGGCAGG + Intergenic
934696613 2:96404845-96404867 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
937061220 2:118981808-118981830 CAGAGCAGCCAGTGGGCGGTGGG + Intronic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938548835 2:132361149-132361171 CAGGGCAGGCATTGGGGGGCGGG + Intergenic
938722152 2:134076515-134076537 CAGAGCAGGCACCGGGAGTGGGG + Intergenic
938812193 2:134863659-134863681 CGGCCCAGGCACTGGGCGGCTGG - Intronic
940364871 2:152837134-152837156 CAGATCAGGGAAAGGGCTGCAGG - Intergenic
941059303 2:160827481-160827503 CAGCTCAGGCACAGAGGGGCAGG + Intergenic
941751461 2:169139265-169139287 CAGAGCAGGCAAAAGGGAGCCGG + Exonic
943511919 2:188836586-188836608 CAGCTCAGGCCCAGGGGGGCTGG - Intergenic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948492070 2:238320324-238320346 CAGAGCAGGCGGGGCGCGGCGGG - Intergenic
948496228 2:238351538-238351560 CACGGCAGGCACAGGGGCGCAGG + Intronic
948533786 2:238631417-238631439 CATTGCAGGCACAGGGAGGGAGG + Intergenic
948844710 2:240677502-240677524 GAGGGCAGGCCCAGGGAGGCGGG + Intronic
948849150 2:240697377-240697399 GAGGGCAGGCCCAGGGAGGCGGG - Intronic
1168745480 20:236081-236103 CAGGGCAGGCACACAGCAGCTGG + Intergenic
1170694719 20:18647900-18647922 CAGAGCAGGAACAGATGGGCAGG + Intronic
1170847493 20:19974734-19974756 CAGAGCTGACGCAGGGAGGCAGG - Exonic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172261339 20:33568552-33568574 CAGAGCAGGCACGCGCCCGCCGG - Intronic
1172447463 20:35000713-35000735 CAGAGCAGGTGCAGGCCTGCTGG + Intronic
1172448533 20:35005822-35005844 CACAGCAGGCAGTGGGCTGCTGG + Intronic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173429964 20:42978899-42978921 CAGAGCAGCCGAAGGGCTGCTGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173849398 20:46208343-46208365 CAGAGCAGGGATGGGGCAGCTGG - Intronic
1173920812 20:46743537-46743559 CAGAGGAGACACACGGCGGGAGG - Intergenic
1174315650 20:49698737-49698759 CAACACAGGCACAGGGTGGCAGG - Intronic
1174315920 20:49701557-49701579 CAACACAGGCACAGGGTGGCAGG - Intronic
1175330143 20:58158049-58158071 CAGAGCAGGCCCAGGGGCCCTGG - Intronic
1175720157 20:61280906-61280928 CGCAGCAGGCAGCGGGCGGCAGG - Intronic
1176074005 20:63240293-63240315 CAGAACAGGCAGAGAGGGGCAGG - Exonic
1176104495 20:63379545-63379567 CAGAGCAGGCACTGGGAGCAGGG - Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176165147 20:63668919-63668941 CAGCTCAGGCACAGGCCTGCAGG + Intronic
1176204684 20:63881920-63881942 CAGGACAGGCAAAGGGCAGCAGG - Intronic
1176296457 21:5075962-5075984 CAGAGCAGGCCCCGGGGGGCAGG + Intergenic
1178711881 21:34924369-34924391 TAGAGGTGGCACAGGGTGGCTGG + Intronic
1178754428 21:35335073-35335095 CAGAGCAGGCACTGGTAGCCAGG + Intronic
1179809253 21:43859772-43859794 CAGAGCAGCCCCAGGACTGCTGG + Intergenic
1179860592 21:44186159-44186181 CAGAGCAGGCCCCGGGGGGCAGG - Intergenic
1180105469 21:45615611-45615633 CAGAGCAGCCCCGGGGGGGCAGG + Intergenic
1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG + Intergenic
1180667895 22:17529258-17529280 CAAAGCAAGCACAGGAAGGCTGG + Intronic
1180667905 22:17529315-17529337 CAGAGCAAGCACAGGAAGGCTGG + Intronic
1181167799 22:20992734-20992756 CAGAGCCTCCACAGTGCGGCTGG - Intronic
1181512275 22:23394324-23394346 CAGAGCAGGTCCAGGGTGGGGGG + Intergenic
1181753391 22:25005771-25005793 CAGAGAAGACACAGGGCTGATGG - Intronic
1181788392 22:25243991-25244013 CAGGGCAGCCACAGGACGCCTGG - Intergenic
1182151108 22:28027800-28027822 CAGGGCAGGGACAGGCTGGCAGG + Intronic
1182697637 22:32207309-32207331 CAGAGCAGTAGGAGGGCGGCTGG + Intergenic
1182814230 22:33145268-33145290 CACAGCAGGCACATGGTGGTAGG - Intergenic
1182863295 22:33580072-33580094 TAAAGCAGACACAAGGCGGCCGG + Intronic
1183292731 22:37012617-37012639 CAGGGCAGGAGCAGGGTGGCAGG + Intronic
1183347600 22:37316554-37316576 CAGAGCAGGCAGTGGAGGGCTGG + Intergenic
1183354187 22:37349625-37349647 CAGAGAAGGCACTGGGTGGTGGG + Intergenic
1183515253 22:38261807-38261829 CAGAGCAGGTACAGGGATCCTGG - Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1184358249 22:43996765-43996787 CAGAGGAGGCCCACGGCAGCGGG + Intronic
1184504121 22:44890899-44890921 CAGAGCAGGCACAAGAGGGTGGG + Intronic
1184549464 22:45196828-45196850 CAGAGCGGGGCCAGAGCGGCGGG - Exonic
1184784440 22:46664902-46664924 CGCAGCAGGCACAGGGCCACAGG - Intronic
1184927246 22:47651477-47651499 CAGGGCAAGAACAGGGTGGCAGG + Intergenic
1185182311 22:49370369-49370391 CAGAGCAGAGACAGGGCTGCAGG + Intergenic
1185409961 22:50676731-50676753 GACAGCAGCCACAGGGAGGCAGG - Intergenic
950318351 3:12025778-12025800 CAGAGAAGGCACAGGGTAGGGGG - Intronic
950533797 3:13568178-13568200 CAGACCAGGCTCAGGGCCGGCGG - Intronic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
950703355 3:14765673-14765695 CAGAGCAGGTGCAGGGAAGCTGG + Intronic
951515929 3:23559565-23559587 CAGGACAGCCACAGGGCTGCTGG - Intronic
952241276 3:31533113-31533135 CAGTGCGCGCACAAGGCGGCGGG + Exonic
952862378 3:37824127-37824149 CAGAACAGGACCAGGGCTGCTGG + Intergenic
952868256 3:37872984-37873006 CAGAGGAGGCACAGGAAGTCAGG - Intronic
952952081 3:38533384-38533406 CAGAAGAGGCACAGTGGGGCGGG + Intronic
953191858 3:40695147-40695169 CAGAGCAGGGGCAGGGCAGGAGG + Intergenic
953251339 3:41247793-41247815 CACAGCAGGCCCAGTGAGGCTGG + Intronic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
954107300 3:48416199-48416221 CAGACCAGACACATGGAGGCAGG + Intronic
954316421 3:49804036-49804058 CAGGGCAGGCATAGGGGTGCTGG - Intronic
954333114 3:49901297-49901319 CACAGCAGGCCCAGGGCCACAGG + Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
956426039 3:69136483-69136505 AAGAGCAGGCAAAGTGAGGCTGG + Intergenic
957476719 3:80734838-80734860 CAGTGCAGCCAGAGGGCTGCTGG - Intergenic
959519210 3:107306588-107306610 CAGAGCGAGCACAGGCCTGCTGG - Intergenic
960586079 3:119322759-119322781 AGGAGCAGGCCCAGAGCGGCCGG - Intronic
961362001 3:126373928-126373950 CAGAGCTGGTGCAGGGCTGCTGG - Intergenic
961438052 3:126932832-126932854 CTGAGCAGGCCCAGGGCAGGCGG + Intronic
961451048 3:127002443-127002465 CAGGGCAGGTCCAGGGCAGCAGG - Intronic
961764677 3:129200210-129200232 GAAAGCAGGCACGGGGTGGCAGG - Intergenic
962312227 3:134334699-134334721 CAGAGCTGGCACATTGCAGCAGG + Intergenic
962367431 3:134795727-134795749 CACAGCAGTCCCAAGGCGGCCGG - Intronic
962437350 3:135379320-135379342 CTCACCAGGCACAGGGCAGCTGG + Intergenic
963511916 3:146257133-146257155 CAGAGGTTGCACAGGGCAGCAGG + Intergenic
964499779 3:157335942-157335964 AACAGCAGGCAGAGGGAGGCTGG - Intronic
965439865 3:168699419-168699441 CAGGGCAGGCACAGGGGCCCTGG - Intergenic
968155581 3:196378495-196378517 CAGAGCAGCCCAAGGGCTGCTGG + Intronic
968353433 3:198081088-198081110 GCGAGCAGGCAGAGGGCGCCTGG + Intergenic
968427090 4:531355-531377 GAGAGCAGGCACAGCCCTGCTGG + Intronic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
968601481 4:1512007-1512029 CAGAGCGGGCATAGGGAGGAAGG + Intergenic
968636795 4:1684913-1684935 CACAGCAGGCCCAGGGAGACCGG + Intergenic
969054427 4:4392762-4392784 GGGAGCAGGCAGAGGGCTGCTGG - Intronic
969120196 4:4902946-4902968 CTGAGAAGGCACAGGGCAGAAGG - Intergenic
969231949 4:5838272-5838294 CAGAGGAGGCCCAGGGAGGGAGG + Intronic
969303555 4:6311627-6311649 CAGAGCAGCCCGAGGGCTGCTGG - Intergenic
969479728 4:7441497-7441519 CAGGGGAGGCGCAGGCCGGCAGG + Intronic
969517041 4:7653677-7653699 CAGTGCAGGCGCAGGTGGGCTGG - Intronic
969534516 4:7747598-7747620 CAGAGACGGCTCAGGGCGGGTGG + Intergenic
969829460 4:9782826-9782848 CAGAGCACGCGCAGAGCTGCCGG + Exonic
970599206 4:17627597-17627619 CTGGGCAGGAACATGGCGGCAGG - Exonic
972225679 4:37008420-37008442 CCAAGCAGGCATAGGGCAGCAGG - Intergenic
974437625 4:61876828-61876850 CAGAGCAGCCCGAGGGCTGCTGG - Intronic
975846882 4:78534478-78534500 CACAACTGGCACAGGGCGGTTGG - Intronic
976303365 4:83536122-83536144 CGGAGCTGGCACCGGGCCGCGGG - Intronic
979665090 4:123302652-123302674 CAGAGCAGGACCAAGGCTGCAGG + Intronic
979703592 4:123694690-123694712 AGAAGCAGGCACAGGGCAGCAGG + Intergenic
981833593 4:149029521-149029543 CCAAGCAGGCATAGGGCAGCAGG - Intergenic
984770171 4:183430551-183430573 CAGAGCAGGCAGAGCAGGGCTGG + Intergenic
985520786 5:373236-373258 CAGGGCAGGGCCAGGGCCGCGGG - Intronic
985671805 5:1210636-1210658 CATAGCAGGCACATGGCCTCAGG + Intronic
985671842 5:1210807-1210829 CAGAGCAGGCACAGCCCCCCCGG - Intronic
985971421 5:3381349-3381371 CAGACCAGGGTCAGGGCGGGTGG - Intergenic
988255219 5:28810385-28810407 CGCAGCGGGCACAGGACGGCAGG - Intergenic
989709418 5:44378978-44379000 CAGAGAAGGCACATTGAGGCTGG - Intronic
990699594 5:58460492-58460514 CACAGGAGGCCCCGGGCGGCCGG - Intergenic
992620918 5:78591969-78591991 CAGAGCTGGCGCAGGAGGGCTGG + Intronic
993020488 5:82585074-82585096 CAGAGCAGGCACAGAGCTGCAGG - Intergenic
996404773 5:123094328-123094350 CAGAGGAGGCGCAGGGCAGAAGG - Intronic
997673724 5:135696835-135696857 CAGTGCAGCCACAGGGGAGCTGG + Intergenic
997878091 5:137566886-137566908 CAGAGCAGGGACGGGCAGGCAGG - Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998452267 5:142244241-142244263 GAAGGCAGGCACAGGGGGGCTGG - Intergenic
1000600905 5:163273581-163273603 CAGAGCAGCCCGAGGGCAGCTGG + Intergenic
1001602072 5:172935345-172935367 CAGAGCAGGCGCAGGGTGGCTGG - Intronic
1002186668 5:177457900-177457922 CAGAGCCGGCCCAGGGAGGGAGG + Intronic
1002428269 5:179188277-179188299 CAGAGAAGCCACAGAGCAGCAGG - Intronic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003315871 6:5011440-5011462 CAGTGCAGGCACTGAGCGGAAGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083465 6:21980660-21980682 CAGAGCAGGAACACGGAGGTAGG - Intergenic
1005116726 6:22346525-22346547 CAGAGCAGGGACACCACGGCAGG + Intergenic
1005487650 6:26316496-26316518 CATAGCAGACATAGTGCGGCAGG - Intergenic
1005842359 6:29752167-29752189 TAGAGCTGGCACAGGGAGGAAGG - Intergenic
1006520045 6:34565976-34565998 CAGGGCAGGCCCAGGCAGGCAGG - Intergenic
1006884508 6:37369651-37369673 CAGGGCAGGTACAGGTCAGCTGG + Intronic
1006984574 6:38168225-38168247 CAAAGCAGGCACAGAGAGGCCGG - Intergenic
1007418059 6:41703489-41703511 CAGACCAGCCACAGGGAGGCTGG - Intronic
1007518390 6:42431513-42431535 CAGGGCAGCCACAGGGCAGTAGG - Intronic
1008330733 6:50241076-50241098 CAGAGCAGGCACCGGGAGTGGGG + Intergenic
1008551234 6:52633306-52633328 CACAGCAGGCAGTGAGCGGCAGG - Intergenic
1013094260 6:106930000-106930022 AAGGGCAGGCACAGGGAGTCTGG - Intergenic
1013161010 6:107544862-107544884 CAGAGCAGGCAGAGGCCAGCAGG - Intronic
1013351589 6:109310795-109310817 CAGAGGAGGCACAGTGCCTCGGG - Intergenic
1014453851 6:121614413-121614435 CAGAGAAGGCAGTGGCCGGCAGG + Intergenic
1014904384 6:127008606-127008628 CAGAGCCTGCACTGGGCGGGTGG - Intergenic
1016447168 6:144146251-144146273 CAGAGCAGGCACTGGGTGCGGGG - Intergenic
1017671301 6:156771942-156771964 CAGAGCTGGAATCGGGCGGCAGG - Intergenic
1017914119 6:158818830-158818852 GAGAGGGGGCACAGGGCGGGCGG + Intronic
1018733188 6:166668675-166668697 CTGAAGAGGCACAGGGAGGCTGG + Intronic
1018838493 6:167502539-167502561 CAGGGCAGGCCCAGGGTGGAGGG - Intergenic
1018901338 6:168053332-168053354 CAGAGCTGGCAGTGGGAGGCTGG - Intergenic
1019058247 6:169237854-169237876 CAGAACGGGCACAGGGCAGCTGG + Intronic
1019463902 7:1175945-1175967 CGGAGCAGGCACACGGCCTCAGG - Intergenic
1019565022 7:1674824-1674846 CAGAGGAGGCACAGCCGGGCGGG + Intergenic
1019735523 7:2648183-2648205 CAGAGCAGGCCCAGTGCAGGGGG - Intronic
1020182768 7:5934966-5934988 CAGAGCAGGCACTCGGTAGCGGG + Intronic
1020300144 7:6789791-6789813 CAGAGCAGGCACTCGGTAGCGGG - Intronic
1020706136 7:11546158-11546180 CAGAGCAGCAACAGGGTGGTGGG - Intronic
1021731186 7:23597263-23597285 CAGGGTAGGTGCAGGGCGGCTGG + Intergenic
1021911525 7:25390061-25390083 CAGAGGAGGCACCTGGAGGCAGG - Intergenic
1021958897 7:25852919-25852941 AGGCCCAGGCACAGGGCGGCGGG - Intergenic
1022423533 7:30246336-30246358 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
1023074900 7:36472986-36473008 CCAAGCAGGCACAGGGCAGCAGG - Intergenic
1023259673 7:38345777-38345799 GAGAGCAGGCCCAGGGCAGAAGG + Intergenic
1023260142 7:38350102-38350124 GAGAGCAGGCCCAGGGCAGAAGG + Intergenic
1023261122 7:38359256-38359278 GAGAGCAGGCCCAGGGCAGAAGG + Intergenic
1023805461 7:43869658-43869680 CTGAGCATTCACAGGGCTGCGGG - Intronic
1024045436 7:45582553-45582575 CAGGGCAGGCACCTGGCGGGGGG + Intronic
1024046115 7:45586921-45586943 GAGTGCAGGCACAGGTCGGGGGG - Intronic
1024062396 7:45708859-45708881 TGGAGAAGACACAGGGCGGCTGG - Intronic
1024978292 7:55133729-55133751 CAGTGCAGAGCCAGGGCGGCAGG - Intronic
1025021712 7:55485633-55485655 CAGTGCAGCCACAGGACAGCCGG - Intronic
1025264967 7:57449372-57449394 CAGGGCAGGCACCGGGTGGGAGG - Intergenic
1026940515 7:74285161-74285183 CAGAGGCTGCACAGGGTGGCAGG - Intergenic
1026994155 7:74605099-74605121 CAGAGCAGACACAGGGTGGCTGG + Intergenic
1027197005 7:76037553-76037575 TTGAGCAGACACAGGGAGGCAGG - Intronic
1028485879 7:91356701-91356723 CAGCGCAGGCACAGCTCAGCTGG - Intergenic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029372026 7:100156381-100156403 CAGAGCATGCACAGGCTGGTAGG - Exonic
1029465120 7:100720611-100720633 CAGAGCAGGGGCAGGACGCCTGG - Intergenic
1030601301 7:111596308-111596330 CAGAGCAGCCCCATGGCTGCTGG + Intergenic
1030628869 7:111873428-111873450 CCGAGCACGCGCAGGGCAGCGGG + Intronic
1031564410 7:123277551-123277573 CAAAGCAGCCACAGAGCAGCAGG - Intergenic
1031837106 7:126691324-126691346 CAGAGCAGGCACCGGGAGTGGGG + Intronic
1031873015 7:127108112-127108134 CAGAGAAGGCAAAGGGCAGGAGG - Intronic
1033607562 7:142938509-142938531 CAGAGAAGCCGCAGTGCGGCAGG - Intergenic
1034825624 7:154259881-154259903 CAGAGCAGGCACGTGGCTGCTGG + Intronic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035294784 7:157860938-157860960 CAGAACAGGCACAGATGGGCTGG + Intronic
1035521070 8:275290-275312 AAGAACAGGCACTGGGAGGCGGG - Intergenic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1036026336 8:4913149-4913171 CAGAACAGGCACAGGACAGTGGG + Intronic
1036656739 8:10681813-10681835 CAGTGGAGGCACAGGGCAGCCGG + Intronic
1038490232 8:27965434-27965456 CAGAGCAGGCACATAGAGGGAGG - Intronic
1038628434 8:29217199-29217221 CTTAGCAGGCACAGGCAGGCCGG - Intronic
1039413237 8:37373209-37373231 GGAAGCAGGCACAAGGCGGCAGG + Intergenic
1039443427 8:37611471-37611493 CAGAGCAGGAAGAGGGGGACAGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041491471 8:58438024-58438046 CAGAGGCTGCACAGGGCAGCTGG - Intronic
1042155660 8:65841809-65841831 CCGAGGAGCCCCAGGGCGGCGGG - Exonic
1046837634 8:118820777-118820799 CAGAGCAGCCCCAGGGCTGCTGG + Intergenic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049239862 8:141531838-141531860 CAGAGCAGGGGCAGGAAGGCAGG + Intergenic
1049331291 8:142055411-142055433 AAGTCCAGGCACAGGGGGGCTGG - Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049376308 8:142290931-142290953 CAGTGCAGACACAGAGGGGCAGG + Intronic
1049444707 8:142624615-142624637 GGGAGAAGGCACAGGGCGGGAGG + Intergenic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1049761354 8:144333176-144333198 CTGTGCAGGCCTAGGGCGGCGGG - Exonic
1051894631 9:21974835-21974857 GAGAGCAGGCAGCGGGCGGCGGG - Exonic
1052521574 9:29554431-29554453 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1054333728 9:63784616-63784638 CAGGGCAGGCATTGGGGGGCGGG + Intergenic
1055335590 9:75230013-75230035 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1056791395 9:89627607-89627629 CAGAGCAGGGCCAGTGGGGCAGG - Intergenic
1057225078 9:93288914-93288936 CAGAGCAGTCACAGGAGGGGAGG - Exonic
1057739236 9:97697356-97697378 CAGAGGCGGTGCAGGGCGGCTGG - Exonic
1057880339 9:98788275-98788297 CAGAAGAGGCACAGCTCGGCAGG + Intronic
1060542731 9:124441542-124441564 CAGAGCCGGGCCAGGGCGGTGGG - Intergenic
1061148949 9:128818205-128818227 CAGAGCAGGCACAGGGCCCCAGG - Intergenic
1061264358 9:129496822-129496844 CCGAGCTGGCACCGCGCGGCCGG + Intergenic
1061385687 9:130288149-130288171 CAAATCAGACACAGGGCAGCTGG + Intronic
1061928229 9:133818066-133818088 CAAAAAAGGCAGAGGGCGGCCGG + Intronic
1062022624 9:134326582-134326604 CGGCGCAGGCAGCGGGCGGCGGG - Exonic
1062089161 9:134665678-134665700 CAGAGCAGGGACAGGGACGTGGG + Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062136008 9:134928905-134928927 CAGAGCTGCCACAGGGCAGTTGG + Intergenic
1062205733 9:135335856-135335878 CAGAGCAGGTGCAGGGGTGCTGG + Intergenic
1062306087 9:135907719-135907741 CGGGGCAGGCACAGGCCTGCGGG - Intergenic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1062376480 9:136264054-136264076 CAGGGCTGGCACAGGCTGGCTGG + Intergenic
1062696339 9:137877986-137878008 GAGAGCGGGCCCGGGGCGGCGGG + Exonic
1203735167 Un_GL000216v2:130663-130685 CAGAGCAGCCCAAGGGCTGCTGG + Intergenic
1185487511 X:494425-494447 GAGAGCAGGCCCCGGCCGGCCGG + Intergenic
1186655781 X:11610298-11610320 CAGAGCAGGCACAGTGCCTGGGG - Intronic
1186780999 X:12911835-12911857 CACAGAAGGCACAGGGCTGTAGG + Intronic
1189262472 X:39688660-39688682 CAGCGCAGGGCCAGAGCGGCTGG + Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192916089 X:75652534-75652556 CAGGGCAGGCACCGAGCTGCAGG - Intergenic
1195092587 X:101475452-101475474 CAAAGCTGGCAGTGGGCGGCGGG + Intronic
1199541282 X:148960348-148960370 CCAAGCAGGCATAGGGCAGCAGG - Intronic
1200065015 X:153500086-153500108 CAGGCCAGGCCAAGGGCGGCGGG - Intronic
1200103827 X:153701542-153701564 CAGATCAGGCCTAGGGCAGCAGG + Intronic
1200239510 X:154486440-154486462 GAGGGCGGGCACGGGGCGGCCGG - Intronic
1202625847 Y:56857679-56857701 CAGAGCAGCCCGAGGGCTGCTGG - Intergenic