ID: 1122987957

View in Genome Browser
Species Human (GRCh38)
Location 14:105221289-105221311
Sequence TGACGTTCCCCCGACCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122987954_1122987957 -3 Left 1122987954 14:105221269-105221291 CCACGCCCAAGCTCAGCAAGTGA 0: 1
1: 0
2: 2
3: 9
4: 122
Right 1122987957 14:105221289-105221311 TGACGTTCCCCCGACCATGTTGG 0: 1
1: 0
2: 1
3: 5
4: 30
1122987956_1122987957 -9 Left 1122987956 14:105221275-105221297 CCAAGCTCAGCAAGTGACGTTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1122987957 14:105221289-105221311 TGACGTTCCCCCGACCATGTTGG 0: 1
1: 0
2: 1
3: 5
4: 30
1122987955_1122987957 -8 Left 1122987955 14:105221274-105221296 CCCAAGCTCAGCAAGTGACGTTC 0: 1
1: 0
2: 0
3: 9
4: 69
Right 1122987957 14:105221289-105221311 TGACGTTCCCCCGACCATGTTGG 0: 1
1: 0
2: 1
3: 5
4: 30
1122987953_1122987957 8 Left 1122987953 14:105221258-105221280 CCTCGTCATTGCCACGCCCAAGC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1122987957 14:105221289-105221311 TGACGTTCCCCCGACCATGTTGG 0: 1
1: 0
2: 1
3: 5
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122987957 Original CRISPR TGACGTTCCCCCGACCATGT TGG Intronic
914394764 1:147254790-147254812 TGAAGTTCCCACAACCCTGTAGG - Intronic
921815693 1:219560937-219560959 TGATGTGCCCACTACCATGTGGG + Intergenic
1066279632 10:33903314-33903336 TGACTTGCCCCAGACCATATAGG - Intergenic
1069598102 10:69685966-69685988 TGACGTCACCCCGACCATTTGGG + Intronic
1083202248 11:61127586-61127608 AGATCTTCCCCCGACCATGCTGG + Exonic
1084328607 11:68416416-68416438 TGACGTTCCTCAGTCCATGCAGG - Exonic
1104172586 12:126296527-126296549 AGACGTTCCTCCCACCACGTTGG - Intergenic
1121823768 14:96993558-96993580 TGAGGTTCCCTCTACCATGTCGG + Intergenic
1122987957 14:105221289-105221311 TGACGTTCCCCCGACCATGTTGG + Intronic
1132849413 16:2018028-2018050 TGACCTGCCCCAGATCATGTTGG - Intronic
1145012374 17:19377113-19377135 TGACTATGCCCCGACCATCTTGG + Intronic
1159533167 18:69681494-69681516 TAACTTTCCCCATACCATGTGGG - Intronic
1165830876 19:38729612-38729634 GGAGGTTCCCCCGACCAGGTTGG + Exonic
1166352140 19:42204313-42204335 TGAGGTTCCACCTACAATGTTGG - Intronic
925916690 2:8612044-8612066 TGACCACCCCCCGACCATGTTGG + Intergenic
928712016 2:34017881-34017903 TGACCTTCTCCCCAGCATGTGGG - Intergenic
1169501805 20:6167722-6167744 TGAGCTACCCCCGAACATGTTGG + Intergenic
1172393688 20:34583944-34583966 TCAGGTTCCCCAGACCATCTAGG + Intronic
1174050196 20:47762497-47762519 TCACTTTCCCCCGATCATATGGG + Intronic
1175475527 20:59271146-59271168 TGAGGTCCCCCAGACCCTGTCGG - Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1177498683 21:21921768-21921790 TGAGGTTCCACTGACCATGAAGG - Intergenic
949414435 3:3800004-3800026 TGAGGTTCCCCAGACCCCGTAGG - Intronic
950418995 3:12885740-12885762 AGACTTTCCCCTGGCCATGTGGG + Intergenic
955529877 3:59862162-59862184 TGAGGTCTCCCCCACCATGTGGG - Intronic
962307640 3:134302343-134302365 TGACTTTCCCAGGACCATGCTGG + Intergenic
968625698 4:1625758-1625780 TGGCGTGACCCTGACCATGTGGG - Intronic
979099815 4:116599794-116599816 GGAGGTTCCCCCGACCAGGTTGG + Intergenic
984630146 4:182052388-182052410 TGACGTTCCCACCAACAGGTGGG + Intergenic
993176385 5:84491326-84491348 TGACTTTCCCCTGTCCATCTGGG - Intergenic
1026303586 7:69120582-69120604 AGACGTGCCCCCGACCACCTTGG - Intergenic
1028222262 7:88211555-88211577 TGACTTCCCACCCACCATGTTGG - Intronic
1044993332 8:97816102-97816124 TGACTTTGCCCTGAACATGTTGG + Exonic
1048070106 8:131012160-131012182 TGACTTTCACCTGAGCATGTTGG + Intronic
1048528663 8:135227709-135227731 TGACGTTCCCCCAACCCAGATGG + Intergenic
1049214458 8:141401448-141401470 TGACGTCCCCCCGGCCATGTCGG + Intronic
1185494274 X:542546-542568 TGACCATCCCAAGACCATGTCGG + Intergenic