ID: 1122988940

View in Genome Browser
Species Human (GRCh38)
Location 14:105227509-105227531
Sequence CAGAAGGGACCTGGGCGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122988940_1122988948 10 Left 1122988940 14:105227509-105227531 CCTCGGCGCCCAGGTCCCTTCTG 0: 1
1: 0
2: 3
3: 18
4: 244
Right 1122988948 14:105227542-105227564 CACCCCTACCCGATCCTGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 163
1122988940_1122988955 26 Left 1122988940 14:105227509-105227531 CCTCGGCGCCCAGGTCCCTTCTG 0: 1
1: 0
2: 3
3: 18
4: 244
Right 1122988955 14:105227558-105227580 TGCCCGGACCTCTGCTCACTAGG 0: 1
1: 0
2: 2
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122988940 Original CRISPR CAGAAGGGACCTGGGCGCCG AGG (reversed) Intronic
900424745 1:2571409-2571431 CAGAGGGGACCTGGACACCGGGG + Intergenic
901026395 1:6280766-6280788 CAGAGGCGACCTGGACGCCCAGG + Intronic
901143882 1:7052573-7052595 CAGAAGGCACGTGGGCGAGGAGG - Intronic
901362004 1:8709403-8709425 TACAAGGGAGCTGGGTGCCGTGG - Intronic
901436148 1:9248510-9248532 CAAAATGGAGCTGGGCGCAGTGG + Intronic
902092618 1:13915601-13915623 CAGAGGGCAACTGGGCGCTGAGG - Intergenic
903226326 1:21895934-21895956 CAGTGGGGACCTGGGCAGCGGGG - Exonic
904785509 1:32979771-32979793 CAGAAGGGAGCCGGGTGCAGTGG + Intergenic
907326979 1:53644660-53644682 CAGATGGGACCAGGGCCCGGAGG + Intronic
908427727 1:64024191-64024213 CAAATGGGAGCTGGGCGCAGTGG + Intronic
908759324 1:67497471-67497493 AAGAAGACACCTGGGCGCGGTGG - Intergenic
912492694 1:110070687-110070709 GGGGAGGGACCTGGGCGCGGGGG + Exonic
914702954 1:150150397-150150419 CCGAGGGGACCGGGCCGCCGGGG - Intronic
916250812 1:162736072-162736094 CTGAAGGGACCTGGGAGCAGTGG + Intronic
922232965 1:223702136-223702158 AAGAAGGAGGCTGGGCGCCGTGG + Intronic
922484077 1:225959687-225959709 AAGAAGGGACCCGGGCACAGTGG + Intergenic
923400887 1:233614590-233614612 TAGAGGGGCCCGGGGCGCCGGGG - Intronic
1063661036 10:8035136-8035158 CAGAAGGGACCCCGGCTCCCAGG - Intergenic
1064324209 10:14333555-14333577 CAGACAGGACCTGGGCCCTGGGG + Intronic
1070023261 10:72607351-72607373 AAAAAGGGAGCTGGGCGCAGTGG + Intronic
1071565860 10:86670977-86670999 CAGAAGGGCCCTGCGAGCCCCGG - Intronic
1072950197 10:99840430-99840452 CAGAAGGGTCGAAGGCGCCGCGG - Intronic
1075802645 10:125162006-125162028 CGGAAGGGAGCTGGTGGCCGTGG + Intergenic
1076296822 10:129391965-129391987 CAGAAGGGGTCTGGGAGCCCTGG + Intergenic
1076481533 10:130788250-130788272 AAGAAGGCACCTGGGCTCAGAGG - Intergenic
1076513992 10:131033002-131033024 CAGAAGGGACCTGGGTGGGGGGG - Intergenic
1076599976 10:131651029-131651051 CAGAAGGAACCTGCGCTCCGTGG - Intergenic
1076986018 11:236446-236468 GAGGCGGGACCGGGGCGCCGGGG - Intronic
1077020407 11:414741-414763 CATATGGGTCTTGGGCGCCGTGG + Intronic
1077339291 11:2018828-2018850 CCGAGGGGACCTGGGCGAAGGGG - Intergenic
1077495898 11:2886277-2886299 CGGGACGGAGCTGGGCGCCGGGG - Intergenic
1081494812 11:43597920-43597942 CAGGAGGGGGCTGGGCGCGGTGG - Intronic
1082836481 11:57654515-57654537 GAGAAAAGAGCTGGGCGCCGTGG + Intronic
1082909199 11:58351038-58351060 CAGAAGGTACCTGGGCTCCTAGG - Intergenic
1083198733 11:61106522-61106544 ATGAAGGGACCTGGGGGCCCAGG + Intronic
1083266066 11:61547382-61547404 CAGAAGGGACCAGGACCCCGGGG + Intronic
1083941759 11:65899914-65899936 CAGAAGGGGCGTGGGCGCCTAGG - Intronic
1085119659 11:73958929-73958951 CAGGACGGCCCTGGGTGCCGGGG - Intronic
1085299889 11:75451605-75451627 GAGAAGGGGCCTGAGTGCCGAGG - Intronic
1085468630 11:76741606-76741628 CAGGAGGGACCTGGGGCCTGGGG + Intergenic
1086257375 11:84893503-84893525 AAGAAGGGACCTGAGCTCCTGGG - Intronic
1089559611 11:119337225-119337247 CAGAAGGGCCCAGGGCCCAGGGG + Exonic
1202822275 11_KI270721v1_random:74010-74032 CCGAGGGGACCTGGGCGAAGGGG - Intergenic
1091450560 12:569946-569968 GAGACGTGACTTGGGCGCCGCGG + Intronic
1096225672 12:49865469-49865491 CAGAAGGGATCTGGAGGCAGGGG + Intergenic
1097882531 12:64699140-64699162 AAGAAGGGGGCTGGGCGCGGTGG + Intergenic
1103921990 12:124403981-124404003 CAGCAGCAACCTGGGGGCCGGGG - Intronic
1111951692 13:94713194-94713216 CAGAGGGGCCCCGGGCGCGGCGG - Intergenic
1113379189 13:109786945-109786967 GGGAAGGGCCCTGCGCGCCGTGG - Intergenic
1113784524 13:112995528-112995550 CAGAGGGGAGCTGGCGGCCGAGG + Intronic
1113836149 13:113329911-113329933 AAGGAGGGAGCTGGGCGCCCAGG + Intronic
1120958833 14:90106285-90106307 AAGAAAGGTCCTGGGCGCAGTGG + Intronic
1122299157 14:100722330-100722352 GAGAGGGGACCTGGGGGCAGAGG - Intergenic
1122571356 14:102704715-102704737 TAGAAGGGGGCTGGGCGCGGTGG - Intronic
1122688915 14:103522525-103522547 CAGAGGGGACCGGCACGCCGGGG + Intronic
1122776037 14:104117301-104117323 CAGCGGGGATCTGGGCGCAGGGG + Intergenic
1122839792 14:104451631-104451653 CAGAAGGAACCTAGGCTCCGGGG + Intergenic
1122952139 14:105050893-105050915 CAGAGGGGACATGGGCACTGTGG + Exonic
1122964095 14:105113000-105113022 CAGAAGGGTCGAAGGCGCCGCGG - Intergenic
1122983996 14:105203839-105203861 CAGAAGGCACCTGGGGGTTGGGG + Intergenic
1122988940 14:105227509-105227531 CAGAAGGGACCTGGGCGCCGAGG - Intronic
1125347840 15:38736909-38736931 CAGAAGGGACCTGGGGAGAGGGG + Intergenic
1126131634 15:45347676-45347698 CAACATGGACCTGGGCGCAGAGG + Intergenic
1127833833 15:62774016-62774038 CAGAAGGGAATTGGGCGGGGTGG - Intronic
1127847287 15:62881906-62881928 CTGAAGAGACCTGGGGGGCGGGG + Intergenic
1129060864 15:72859356-72859378 GAGAAGGGCCCTGTGAGCCGTGG - Intergenic
1129732160 15:77938783-77938805 GAGAGGGGACATGGGAGCCGTGG + Intergenic
1131258291 15:90875661-90875683 GAGCAGGCACCTGGGAGCCGAGG + Exonic
1131485924 15:92820528-92820550 CAAAAGGGCCCTGGGCGCCGGGG - Intergenic
1132647209 16:1004548-1004570 GAGATGGGGGCTGGGCGCCGTGG + Intergenic
1132697922 16:1210185-1210207 CAGGAGGGACCTGGGGGCGGGGG - Intronic
1132711798 16:1272154-1272176 CAAAAGGGACCTGCGCGTAGTGG + Intergenic
1133002921 16:2860174-2860196 CAGGAGGGCCCTGGACGCCCTGG - Intergenic
1133157058 16:3882609-3882631 CAGAAGTGATATGGGAGCCGAGG - Intergenic
1133331533 16:4977713-4977735 TAGAAGGGACCAGGGAGCCCCGG - Intronic
1133750485 16:8721411-8721433 CAGGTGTGACCTGGGCACCGGGG - Intronic
1133750742 16:8723361-8723383 TAGAAGGGAGCTGGGTGCCCAGG - Intronic
1134583790 16:15394384-15394406 AAGAAGGGAACTGGGCGCGGTGG - Intergenic
1134586628 16:15417110-15417132 AAGAAGGGAACTGGGCGAGGTGG - Intronic
1135030216 16:19032199-19032221 CAGAAGAGACCAGGGTGCTGTGG + Intronic
1135775013 16:25250021-25250043 AAGAAGGAGCCTGGGCGCAGTGG + Intronic
1135943550 16:26843656-26843678 CTGAAGGGGGCTGGGCGCAGGGG - Intergenic
1136192494 16:28624986-28625008 AAGAAGGGAACTGGGCACGGTGG + Intergenic
1136776106 16:32872722-32872744 CAGACGGGACTTGGGCTTCGAGG + Intergenic
1136894509 16:33988790-33988812 CAGATGGGACTTGGGCTTCGAGG - Intergenic
1137567866 16:49544743-49544765 CAGCAGTGACCTGGGAGCCAGGG + Intronic
1137711817 16:50571957-50571979 CAGAAGGGAGCAGGGCGGCTGGG - Intronic
1139692596 16:68650713-68650735 GAGAAGAGACCTGGGCGTGGAGG - Intronic
1139859479 16:70009523-70009545 AAGAAGGGAACTGGGCACGGTGG - Intergenic
1140431402 16:74907120-74907142 CAGATGTGACCTGGGCCCCATGG - Intronic
1140473283 16:75226588-75226610 CAGAAGGGACCCGAGGGGCGAGG - Intergenic
1141567687 16:84914538-84914560 CAGAAGGAACCAGGGCTCCTTGG - Intronic
1203078522 16_KI270728v1_random:1134831-1134853 CAGACGGGACTTGGGCTTCGAGG + Intergenic
1142695093 17:1629016-1629038 CGGGAGGGGCCTGGGCGCTGCGG + Intergenic
1143475371 17:7200032-7200054 CAAAAGGAACCTGGGCTCCTTGG - Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146693264 17:34891063-34891085 CAGAAGGGACCTGGGGGCCTGGG - Intergenic
1147110189 17:38256551-38256573 CAGAAGGGTCCGGGGCGGGGGGG + Intergenic
1147440622 17:40444827-40444849 GAGAAGGGGCCAGGGCGCCAGGG + Intronic
1147907598 17:43833056-43833078 GACGAGGGAGCTGGGCGCCGCGG - Intronic
1148419319 17:47531868-47531890 CAGAAGGGTCCGGGGCGGGGGGG - Intronic
1148907513 17:50920637-50920659 CAGAAGGGGGCTGGGTGCAGTGG - Intergenic
1150292258 17:63988604-63988626 CAGAAGGGGTCTGGGGGCGGGGG - Intergenic
1150645303 17:66974182-66974204 CAGAAGCCAGCTGGGGGCCGAGG + Intronic
1151486414 17:74403859-74403881 AGAAAGGGACCTGGGCGCAGAGG + Intergenic
1151558971 17:74860849-74860871 GGGAAGGGGTCTGGGCGCCGAGG + Intronic
1151817177 17:76477092-76477114 CAGAAGGGGCTTGGGGGCCAGGG + Intronic
1152392237 17:80009822-80009844 CAGAAGGGACCAGGACTCCCGGG + Intronic
1152799741 17:82325314-82325336 CAGGAGGGAGCTGGGGGCGGTGG - Intronic
1152987682 18:334925-334947 CAGGAGGGCCCTGAGGGCCGGGG + Exonic
1153913268 18:9722292-9722314 CAGAAGGAACATGGGAGCGGTGG + Intronic
1158259557 18:55591802-55591824 CAGAAGGGGGCTGGGTGCAGTGG - Intronic
1160376969 18:78420888-78420910 CAGAGGGGACCTGCGGGCGGAGG + Intergenic
1162306251 19:9876039-9876061 CAGTAGGGACCTCGGTGGCGGGG - Intronic
1162385429 19:10357972-10357994 CTGAGGGGACCTGGGCACAGTGG - Intronic
1162480459 19:10924183-10924205 CAGAAGGGGCCTGGGGGTAGGGG + Exonic
1162744611 19:12791520-12791542 CAGCAGGGAGCTGGGAGCTGGGG + Exonic
1162886617 19:13702471-13702493 CAGAAGGGTCGAAGGCGCCGCGG + Intergenic
1162954643 19:14091154-14091176 GAGAGGGGGGCTGGGCGCCGGGG - Intergenic
1162968561 19:14167205-14167227 AGGAAGGGACCTGGGGGCGGGGG - Intronic
1163410175 19:17149264-17149286 AAAAAGGGAGCTGGGCGCAGTGG - Intronic
1164653413 19:29902006-29902028 CAGAAGGGTCGAAGGCGCCGCGG - Intergenic
1166261356 19:41643897-41643919 CAGAAGGGTCGAAGGCGCCGCGG + Intronic
1166285151 19:41821205-41821227 CAGAGGGCACCTGGGCCCTGTGG - Intergenic
1166294624 19:41883042-41883064 CCGCAGGGACCCGGGCGCAGCGG + Intergenic
1166351297 19:42199677-42199699 CTCAAGGGACCTGGGCTCTGTGG - Exonic
1168154318 19:54464596-54464618 CAGTAGGGGCCTGGTCTCCGTGG - Intergenic
1168267930 19:55232329-55232351 CAGAAGGGTCCAGGGAGCCTGGG + Intronic
927863267 2:26573640-26573662 CAGAGGAGACCTGGCCTCCGCGG + Intronic
928542818 2:32299532-32299554 CTCAAGGGGGCTGGGCGCCGTGG + Intronic
929162087 2:38842103-38842125 CAAAAGGCACATGGGCCCCGTGG - Intronic
929216357 2:39417804-39417826 CAGAAGGAACCAGGGCTCCTTGG + Intronic
932326369 2:70864657-70864679 CTGCAGAGACCTGGGCGCTGTGG - Intergenic
932341127 2:70963177-70963199 GAGGAGGTGCCTGGGCGCCGAGG + Exonic
936042326 2:109159376-109159398 CAGAAGGGACTTGGGAACCAGGG + Intronic
936066727 2:109338017-109338039 CAGAAGGAGCCTGGGCGCGGTGG - Intronic
936662211 2:114554993-114555015 CATAATGGACCTGGGCATCGAGG + Intronic
937044167 2:118842324-118842346 CAGAAGGGACCCGGGAGGTGGGG + Exonic
937442238 2:121926405-121926427 CAGAAGGGACATGTGGGCCATGG + Intergenic
944846760 2:203676825-203676847 AAGAAGTGAGCTGGGCGCGGTGG + Intergenic
947533007 2:230924667-230924689 CAGAAGGAGCCTGGGAGCCCAGG - Intronic
947828784 2:233124622-233124644 CAGCATGGCCCTGGGCGCCTGGG - Intronic
948133660 2:235620066-235620088 AAGAAGGTCCCTGGGGGCCGAGG - Intronic
1171349971 20:24494661-24494683 CAGCAGGGACCGGGGCCCTGAGG + Intronic
1175250809 20:57609243-57609265 CAGAAGGGAGCTCGGGGCCTCGG - Intronic
1175753225 20:61513504-61513526 CAGAAGGCACCAGGCCGCCATGG + Intronic
1175922198 20:62455535-62455557 GAGAAGGGGCCTGGGAGGCGGGG - Intergenic
1176032073 20:63017497-63017519 CAGAGGGGGCCTGGGCTCCATGG + Intergenic
1176050995 20:63119736-63119758 CAGGAGGGAGCTGGGAGCTGTGG - Intergenic
1176180054 20:63745589-63745611 CAGATGGGAGGTGGGCGCGGTGG - Exonic
1176265686 20:64208163-64208185 CAGAAGGCCCCTGAGCTCCGGGG + Exonic
1176623811 21:9074930-9074952 CTGGAGAGACCTGGGCGGCGTGG - Intergenic
1178088796 21:29139869-29139891 GAGATGGGGCCTGGGCGTCGTGG - Intronic
1179822941 21:43947310-43947332 CAGAAGTGGCCTGGGGGCCCTGG + Intronic
1179881491 21:44294994-44295016 CAGAGAGGACCTGGGTGGCGCGG + Intronic
1180091523 21:45536009-45536031 GAGCAGGCACGTGGGCGCCGGGG - Intronic
1181102853 22:20552953-20552975 CACAAGAGACCTGGGGGCAGAGG - Intronic
1182493509 22:30690278-30690300 CAGAAGGGGGCCGGGCGCAGTGG - Intergenic
1182829989 22:33297319-33297341 AAGAAGGGGGCTGGGCGCAGTGG + Intronic
1183407929 22:37639580-37639602 GAGGAGTGACCTGGGGGCCGGGG + Exonic
1183731603 22:39621630-39621652 CAGAGGGGGCCTGGGGGCTGGGG + Intronic
1184407092 22:44306417-44306439 CAGAGGGGACCTGGGCTCAGGGG + Intronic
1184932579 22:47692118-47692140 CAGAAGAGGGCTGGGCGCGGTGG + Intergenic
1185300162 22:50075354-50075376 CGGAAGGGACCTGGGCAGCCAGG + Intronic
952738904 3:36716735-36716757 AAGAGGGGACCTGGGCTCTGGGG + Intronic
954080457 3:48210599-48210621 CAGAAGGGTCGAAGGCGCCGCGG + Intergenic
954125462 3:48525441-48525463 CAGAAGGGGCCTGGTCTCAGAGG - Intronic
954453028 3:50581916-50581938 CAGAAGGAACCTGGGTGGGGAGG + Exonic
954750553 3:52811126-52811148 CAGGAGGGACCAGGGTGACGTGG - Intergenic
954807874 3:53230807-53230829 CAGAAGGGGCCGGGGCTCCAGGG - Intronic
955739984 3:62080361-62080383 CAGAAGGGGGCTGGGCGCAGTGG - Intronic
962241879 3:133756919-133756941 GAGAAGGGACCTGGGCCAAGTGG - Exonic
962677084 3:137765179-137765201 CAGCAGGGAGTAGGGCGCCGAGG - Exonic
963253316 3:143120916-143120938 CAGCGGCGTCCTGGGCGCCGGGG - Exonic
966911329 3:184561968-184561990 CAGGAGGATCCGGGGCGCCGGGG - Exonic
967008958 3:185413532-185413554 CAGAATGGGGCTGGGCGCGGTGG + Intronic
967036659 3:185653114-185653136 GAGAAGGAAGCTGGGCGCAGTGG - Intronic
969266441 4:6067034-6067056 CAGGAGGGACCTGGGCATGGTGG - Intronic
969275444 4:6132352-6132374 CAGAAGGCAGCTGGGCACGGTGG + Intronic
971363548 4:25958096-25958118 CAAAAGGCACCTGGCCGCGGAGG + Intergenic
976591009 4:86849968-86849990 CAGAGGGGCCCTGGGCACTGTGG - Intergenic
976720892 4:88167661-88167683 CAGAAAGAGCCTGGGCGCAGTGG - Intronic
978384724 4:108168021-108168043 CCGAAGGGCACTGGGCGGCGAGG + Exonic
978621016 4:110634182-110634204 CTGAAGGGAGCTGGGCCCTGGGG + Intronic
979025058 4:115560043-115560065 CAGAAGTGGACTGGGCGCAGTGG - Intergenic
981338694 4:143595598-143595620 AAGAAGGGAGCCGGGCACCGTGG + Intronic
985295678 4:188435007-188435029 CTGAAGGGGTCTGGGCGCAGTGG + Intergenic
985484368 5:140391-140413 CAGCAGGGACCTGGGGACTGGGG + Exonic
985487813 5:161854-161876 CAGAAGGGGCCTGAGCGCCGTGG + Exonic
985726644 5:1519773-1519795 CAGAAGGCAGCTGGGGGCCATGG + Intronic
997235792 5:132271342-132271364 CAGAGTCGACCTGGGCTCCGAGG + Exonic
998545974 5:143027991-143028013 CAGAAAGGAACTGGGGGCTGTGG - Intronic
999772348 5:154785168-154785190 CAGGAGGCACCTGGGCCCCAGGG - Intronic
1001542559 5:172549828-172549850 CAGAAGTGTCCTGGGCACTGTGG - Intergenic
1002257767 5:177971306-177971328 CAGAGGCGACATGAGCGCCGCGG + Intergenic
1002305600 5:178280860-178280882 CAGGAGGCATCTGGGAGCCGAGG + Intronic
1003049069 6:2764324-2764346 CGGAAGGGTCCCGGGCGCCCAGG + Intergenic
1004615282 6:17282442-17282464 GAGTAGGGACCTGGGGGGCGGGG + Intronic
1006573962 6:35029635-35029657 CAGAAGTCGACTGGGCGCCGTGG - Intronic
1007092486 6:39192859-39192881 CAGAAGGGACCTGGAGGAAGGGG + Intronic
1010428165 6:75749151-75749173 CCGAAGGGGCGGGGGCGCCGGGG - Intergenic
1013288589 6:108700596-108700618 CAGAAGGCCCCTGTGCTCCGTGG + Intergenic
1013332330 6:109116461-109116483 CTTATGGGAGCTGGGCGCCGTGG - Intronic
1013827281 6:114229541-114229563 AAGAAGAGAGCTGGGCGCGGTGG - Intronic
1015476458 6:133664001-133664023 CAGAAGGGTCGAAGGCGCCGCGG + Intergenic
1016993573 6:149945653-149945675 CAAAAGGGTCCTGGGCACGGTGG + Intronic
1017004759 6:150021877-150021899 CAAAAGGGTCCTGGGCACGGTGG - Intronic
1017849349 6:158290573-158290595 CAGAAGGGAGGTGGGAGCAGGGG - Intronic
1018444186 6:163840266-163840288 CAGAAGGGTCCTGGATGCCCAGG + Intergenic
1018942478 6:168318959-168318981 CAGGGGGGACCTGGTCCCCGGGG + Intronic
1018990685 6:168671429-168671451 GAGGAGGGACCAGGGCGCAGGGG - Intronic
1018990704 6:168671482-168671504 GAGGAGGGACCAGGGCGCAGGGG - Intronic
1019177200 6:170165971-170165993 CAGATAGGACCTGGGCACCGTGG + Intergenic
1019299552 7:296368-296390 CAGAAGGGGCCTGGGGACCTGGG - Intergenic
1019479654 7:1260592-1260614 GAGAGGGGAGGTGGGCGCCGAGG - Intergenic
1019626299 7:2017577-2017599 CAGGAAGGATCTGGGCGCCCTGG + Intronic
1020761184 7:12269684-12269706 CAGAAGGGGCCTGGCGGCAGGGG - Intergenic
1027269597 7:76512449-76512471 CAGAAGGGGGCTGGGCGGAGCGG - Intronic
1027320307 7:77006343-77006365 CAGAAGGGGGCTGGGCGGAGCGG - Intergenic
1029456179 7:100673704-100673726 CAGCCGGGTCCTGGGCGCGGCGG + Exonic
1029645617 7:101853896-101853918 CAGGAGGGACCTGACCGCAGTGG + Intronic
1032194447 7:129781029-129781051 CAGAAGGGACCGGGGGGCAGGGG + Intergenic
1032396457 7:131593446-131593468 AAGAAAGGAGCTGGGCGCGGTGG - Intergenic
1032702896 7:134397735-134397757 CAGCAGGGACCTGGGCATCCAGG - Intergenic
1033414723 7:141151851-141151873 CAGAAGGGACCTGAGAGGTGAGG - Intronic
1035013648 7:155743859-155743881 CACAAGGGACATGGGCATCGGGG - Intronic
1035138282 7:156729758-156729780 TAGAAGGGGGCTGGGCGCAGTGG - Intronic
1035228291 7:157445517-157445539 GGGAAGGGACCTGGGGGCAGTGG + Intergenic
1035294873 7:157861347-157861369 CTGAAGGGACCCGGGCTCCTTGG - Intronic
1035619907 8:1028941-1028963 CAGGAGGGACGTGGGCCCTGAGG + Intergenic
1037901418 8:22691538-22691560 GGGCAAGGACCTGGGCGCCGCGG - Intronic
1039194551 8:35016242-35016264 CAAAAATTACCTGGGCGCCGTGG + Intergenic
1039450555 8:37671434-37671456 CAGAAAGTAGCTGGGCGCAGTGG + Intergenic
1039840784 8:41291558-41291580 CAGAAGGGAGCTGGTCTCCAAGG - Intronic
1047203571 8:122785743-122785765 AAGAAGGGCCCTGGGAGCAGTGG + Intronic
1048848678 8:138623539-138623561 CAGAAGAAACCTGGGCCTCGGGG - Intronic
1049230892 8:141480590-141480612 AAGAAGAGAGCTGGGCGCTGGGG - Intergenic
1049696474 8:143986490-143986512 CAGCTGGGCCCTGGGCGCTGAGG + Intronic
1049773003 8:144392377-144392399 CAGAAGGGAGTCGGGCGGCGCGG + Intronic
1052462612 9:28785638-28785660 GAGAAGGGCCCTGGGTGGCGGGG - Intergenic
1052880478 9:33598559-33598581 CAGCAGGGACCTGGTCAGCGGGG + Intergenic
1053072796 9:35111162-35111184 GAGAAGGGACCTGGGAGGCTGGG - Exonic
1053281693 9:36824643-36824665 GAGAAGAGACCTGGGAGCCTCGG + Intergenic
1055090926 9:72364613-72364635 GTGAAGGGACCGGGGCGCCGCGG - Intronic
1055584400 9:77742970-77742992 CAGCAGGAGGCTGGGCGCCGTGG + Intronic
1056800070 9:89684988-89685010 CACAAGGGACCTGCCCGCCAAGG - Intergenic
1057304832 9:93905968-93905990 CAGAAGGGACGCTGGCGTCGGGG - Intergenic
1057334488 9:94145095-94145117 CAGAAGGCAGCTGGGCGCAGTGG + Intergenic
1060064705 9:120494775-120494797 CAGAAGGGTCGAAGGCGCCGCGG + Intronic
1060281812 9:122220131-122220153 CAGAACGGACTCGGGCGTCGGGG - Intronic
1060662473 9:125412421-125412443 GAGAATGGAGCTGGGCGCAGTGG + Intergenic
1061237641 9:129351875-129351897 GAGGAGGGACCTGCGCCCCGAGG - Intergenic
1061485290 9:130917522-130917544 CAGATGGGGCCTGGGGACCGAGG + Intronic
1061841120 9:133359141-133359163 GAGATGGGACTGGGGCGCCGAGG + Intronic
1061986982 9:134135687-134135709 AAGAAGGGGCCTGGTCGCCCGGG + Intronic
1062234598 9:135501745-135501767 CAGAAGGCACTTGGGAGCAGGGG + Intronic
1062620271 9:137417411-137417433 CAGCAGGGGCCTCCGCGCCGCGG - Intronic
1185441108 X:228202-228224 CACAAGGCAGCTGGGCGCGGTGG - Intergenic
1185782450 X:2861411-2861433 CAGATGGGAGCTGGGAGCCCTGG + Intronic
1186311282 X:8322584-8322606 CATAAGGGGGCTGGGCGCAGTGG + Intergenic
1189069973 X:37853135-37853157 CAGAATAGACCGGGGCGCAGTGG + Intronic
1191129851 X:56995785-56995807 CAGAAGGGGCAGGGGCGCAGAGG - Intergenic
1192784968 X:74326283-74326305 CAGAAAGGGGCTGGGCGCAGTGG - Intergenic
1193348972 X:80435068-80435090 CAGAAGGGGGCTGGGCGCGGTGG - Intronic
1194987401 X:100505802-100505824 CACAAGGGACCAGGGCTCCTCGG + Intergenic
1196893149 X:120309477-120309499 CAGACGGGCCCGGGGCGCTGTGG + Intronic