ID: 1122992012

View in Genome Browser
Species Human (GRCh38)
Location 14:105240957-105240979
Sequence GCCCCACGAGACCACGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122992003_1122992012 5 Left 1122992003 14:105240929-105240951 CCACACCACTGTCCGCGTCAGAA 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1122992001_1122992012 28 Left 1122992001 14:105240906-105240928 CCTAGCATCTCAGGAGAGAGAGG 0: 109
1: 0
2: 8
3: 318
4: 9633
Right 1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1122992004_1122992012 0 Left 1122992004 14:105240934-105240956 CCACTGTCCGCGTCAGAAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1122992007_1122992012 -7 Left 1122992007 14:105240941-105240963 CCGCGTCAGAAGCCGGGCCCCAC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122992012 Original CRISPR GCCCCACGAGACCACGGGCA GGG Intronic
901140672 1:7027384-7027406 GGCCCACGAGACCTGGGGGAAGG + Intronic
901427127 1:9189398-9189420 GGCCCCCGAGACCAGGGGCCTGG + Intergenic
905223800 1:36466573-36466595 GCCCCACAAGCCCAGGGCCAGGG - Exonic
912439234 1:109686202-109686224 TCCCCACAGGACCACAGGCAGGG - Intronic
917640165 1:176975591-176975613 GCCCCATGAAAACACAGGCAAGG - Intronic
922779616 1:228241062-228241084 GCACCAGGACACCATGGGCAAGG + Intronic
1065265809 10:23974313-23974335 GCCTCAAGAGACCAGGGGCCTGG + Intronic
1067066421 10:43106510-43106532 GCCCAACGAGACCTCGGTCCAGG + Exonic
1076685251 10:132195734-132195756 GCTCCACCAGCCCCCGGGCAGGG - Intronic
1077462681 11:2718423-2718445 GCCCCATGAGGCTACGGGGAGGG - Intronic
1083774132 11:64884945-64884967 GCCCCAGCAGACCACCAGCAAGG + Intronic
1083928210 11:65822124-65822146 GCCCAACCTGACCATGGGCACGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1098535737 12:71591924-71591946 TCTCCAGGAGACCATGGGCAAGG + Intergenic
1100346660 12:93738299-93738321 GGCCCATGAGACCTCAGGCATGG + Intronic
1104488173 12:129170042-129170064 GCCACACTGGACCACGGCCAGGG + Intronic
1105780479 13:23701779-23701801 GCCCCCAGAGACCACAGCCAGGG + Intergenic
1114671005 14:24411059-24411081 GTCCCACGACCCCACAGGCATGG + Exonic
1122178312 14:99937087-99937109 GCCCCAAGAGCCCACGGGGGTGG + Intronic
1122276609 14:100593971-100593993 GCCCCAGGAAACCTCGGGCCTGG + Intergenic
1122992012 14:105240957-105240979 GCCCCACGAGACCACGGGCAGGG + Intronic
1123759789 15:23423355-23423377 GCCCCAGGACACCAAGGGCAGGG + Intergenic
1124149768 15:27167190-27167212 GGCCCAGGGGACCTCGGGCATGG - Intronic
1132618796 16:854856-854878 CCCCCAGCAGACCCCGGGCAGGG + Intronic
1133113180 16:3561817-3561839 GTCCCACCCGCCCACGGGCAGGG + Intronic
1133170069 16:3977416-3977438 GCCCTACGCAACCTCGGGCAAGG + Intronic
1134456551 16:14399540-14399562 GCCCCAGGACACCAAGGGCAGGG - Intergenic
1138273014 16:55709767-55709789 CCCCCATTAGACCACTGGCATGG + Intergenic
1141606105 16:85154260-85154282 GCCCCAGCAGACCAAGGGGAAGG + Intergenic
1151206692 17:72513151-72513173 GCCCCAAGAGACTCTGGGCAGGG + Intergenic
1152175015 17:78781917-78781939 GCCCCGCGAGACCGCGAGCCCGG + Intronic
1152862804 17:82705571-82705593 GCCCCACGCATCCACGGGCTGGG - Intergenic
1154954415 18:21241509-21241531 GCCTCCCGGGACCACGGGGACGG - Intergenic
1156478859 18:37423668-37423690 GCCTCAGGAGACCAAGGCCATGG - Intronic
1157808626 18:50677481-50677503 GGCCCAGGAGTCCACGGACAGGG + Intronic
1160178877 18:76617580-76617602 CTCCCACGAGACCGCAGGCATGG - Intergenic
1161737543 19:6000847-6000869 GCCCCACGTGACCCAGCGCATGG - Intronic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1165385654 19:35509372-35509394 GACCCACGTGGCCAGGGGCAAGG - Intronic
1165955312 19:39498859-39498881 GCCCCAAGGGACCAAGGGCGGGG - Intergenic
1166366295 19:42280187-42280209 TCCCCACGAGGGCCCGGGCAGGG + Intronic
1166804640 19:45478171-45478193 GCACCAGGAGACCAAGGCCAGGG + Intronic
934712520 2:96525345-96525367 GCCCCTCCATACCACTGGCATGG + Intergenic
942241423 2:173965876-173965898 GCCCCACGAGCCCGGGGGGAGGG + Intergenic
947072590 2:226307445-226307467 GCTCCAGGAGACCCAGGGCAAGG - Intergenic
1172353191 20:34260021-34260043 GCCCCAGGAGACCCCAGGCCTGG - Intronic
1172479342 20:35261708-35261730 GCTTCAGGAGACCCCGGGCAGGG - Intronic
1178906586 21:36642035-36642057 GCCCCAGGAGTCCACAGGCAGGG - Intergenic
1179829143 21:43985108-43985130 TCCCCAGGAGACCACGGCCCAGG - Exonic
1180037397 21:45256814-45256836 GCCCCATGAGGACACGGCCAGGG - Intergenic
1180223571 21:46375747-46375769 CCCCCAGGAGACGTCGGGCAGGG - Intronic
1181026264 22:20129525-20129547 GCCCCACGGGACCACAGGGTAGG + Intronic
1181583260 22:23839310-23839332 GACCCACGACACCACGGGGGCGG + Intergenic
1182301636 22:29340374-29340396 GTCCCAGGAGACCCTGGGCAGGG - Intronic
1183294692 22:37022611-37022633 GCCTCCTGTGACCACGGGCAAGG + Intronic
1183485591 22:38086213-38086235 GCCCCAAGAGAGGGCGGGCAAGG + Intronic
961650090 3:128412964-128412986 GCCCCACAAGGGCACAGGCAGGG + Intergenic
961789884 3:129368083-129368105 GACCCACGAGGTCACAGGCACGG - Intergenic
963294713 3:143533194-143533216 GCCCCACGAGAGCAGGGACTTGG - Intronic
964303089 3:155310613-155310635 GCCCCACGTGATCACTGGCCTGG - Intergenic
964791098 3:160453527-160453549 GCCCCTCCAGACCCAGGGCATGG + Intronic
968225452 3:196969570-196969592 GCCCGCCGATCCCACGGGCACGG - Intergenic
968584661 4:1410619-1410641 GCCCCCGGAGGCCACGGGCTCGG + Intergenic
968832802 4:2941867-2941889 GGCCCATGCAACCACGGGCAAGG + Intronic
969570611 4:8006109-8006131 GCCCCAGGAGAACACGAGCCTGG - Intronic
970593286 4:17577606-17577628 GCCCCAGTAGCCCACGGGCAGGG - Intronic
975778940 4:77819550-77819572 GCCCCCCGAGACCCCGGGCCCGG - Intronic
976390067 4:84497890-84497912 GGCCCCCGAGGCCACGGGCATGG + Exonic
985673559 5:1218824-1218846 GACGCACGAGACCTCGGGCGGGG + Intronic
985692468 5:1321071-1321093 GCCGCCCGAGACCACAGCCAAGG + Intronic
986216203 5:5721469-5721491 GCCCCACCAGACCTCAGGAATGG + Intergenic
986301047 5:6478756-6478778 GCCACAGCAGACCACAGGCAAGG + Intronic
997549335 5:134738437-134738459 GCCCCACGCGACCAAGCGCGAGG - Intergenic
998407043 5:141879827-141879849 GCCCCAGGAGCCCAGGGGCAGGG + Intergenic
1002534272 5:179867630-179867652 TCCCCAGGGGACCACGGGCTGGG - Intronic
1002576592 5:180177437-180177459 GCCGCAGCAGTCCACGGGCAGGG + Intronic
1003041065 6:2687641-2687663 GCCCCATGAGACTGCGGGGATGG - Intronic
1003858948 6:10304307-10304329 GCACCATGAGAACTCGGGCAGGG + Intergenic
1007596320 6:43053387-43053409 GCGCCGCGAGACCCAGGGCAGGG + Intronic
1009658560 6:66578619-66578641 GCCCAATGAAACCAAGGGCAGGG - Intergenic
1013797809 6:113905991-113906013 GCCCTACTAGGCCAGGGGCAAGG - Intergenic
1018028856 6:159826370-159826392 GCCCCACTAGACAGTGGGCAGGG - Intergenic
1019258280 7:65345-65367 GCCCCACTGGACCACGGCTAAGG + Intergenic
1019309942 7:355068-355090 GCCCCAGGAGACCGAGGGCAAGG - Intergenic
1019422040 7:954983-955005 GCCCCCCAAGACCATGGGCATGG + Intronic
1020083912 7:5300432-5300454 GCCCCGCCAGTCCACGGGCAGGG - Exonic
1021884373 7:25124684-25124706 GCCCCAGGAGATCACAGGTAGGG - Intronic
1023046354 7:36213823-36213845 GCTCCACAAGAGCAAGGGCAGGG + Intronic
1025210361 7:57016758-57016780 GCCCCGCCAGTCCACAGGCAGGG + Intergenic
1025661593 7:63560089-63560111 GCCCCGCCAGTACACGGGCAGGG - Intergenic
1035391606 7:158508175-158508197 GCGGCAGGAGACCACAGGCATGG + Intronic
1047762773 8:127966596-127966618 GCCCCACGTGGCTAAGGGCAAGG - Intergenic
1049098418 8:140562422-140562444 GCCACACGGGACCAAGGGCGGGG - Intronic
1049705392 8:144039850-144039872 GCCCCTCCAGACCACGGCGAGGG - Intronic
1054452567 9:65411099-65411121 GACCCTCGAGGCCACAGGCAAGG + Intergenic
1062701055 9:137903465-137903487 ACACAACGAGACCACAGGCACGG - Intronic
1203775240 EBV:69269-69291 GGCCCTGGAGACCACGGACAGGG - Intergenic
1187117681 X:16369957-16369979 GCCCCACGAGACCACAGAGGTGG - Intergenic
1187888058 X:23907617-23907639 GCCCCAAGAGAGCGCGGGGAGGG + Intronic
1192510754 X:71719232-71719254 GCCCCACGGGGCCAGGGCCACGG + Intergenic
1192515943 X:71762321-71762343 GCCCCACGGGGCCAGGGCCACGG - Intergenic
1200076800 X:153555217-153555239 GCCCCCTGAGGCCATGGGCAGGG - Intronic