ID: 1122994459

View in Genome Browser
Species Human (GRCh38)
Location 14:105255392-105255414
Sequence ACCCCAGATGCCACCTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 8, 3: 20, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122994456_1122994459 7 Left 1122994456 14:105255362-105255384 CCATTTATAAAGACAGCTGGGAG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1122994459 14:105255392-105255414 ACCCCAGATGCCACCTGACACGG 0: 1
1: 0
2: 8
3: 20
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122994459 Original CRISPR ACCCCAGATGCCACCTGACA CGG Intronic
900170063 1:1262893-1262915 GCCCCAGGTGCCACCACACAGGG + Intronic
902455269 1:16529412-16529434 AAACCAGATGCCACCTTACAGGG - Intergenic
902473961 1:16670730-16670752 AACCCAGATGCCACCTTACAGGG - Intergenic
902484842 1:16736712-16736734 AACCCAGATGCCACCTTACAGGG + Intergenic
902496901 1:16878475-16878497 AACCCAGATGCCACCTTACAGGG + Intronic
903812271 1:26041419-26041441 CCCCCAGAAGCCACCTGACTAGG + Intronic
906667786 1:47633789-47633811 ACCCCAGTTTCAACCTGTCATGG + Intergenic
907944654 1:59124329-59124351 ACCCAAGAAGGAACCTGACATGG - Intergenic
910079855 1:83328568-83328590 ACCCAGGATGCCACCTTACGTGG - Intergenic
910840620 1:91557477-91557499 ACCTCAGAGGCCAGGTGACAGGG + Intergenic
912529872 1:110312568-110312590 GCCCTAGATGTCACCTGGCAAGG - Intergenic
913658828 1:120989110-120989132 AACCCAGATGCCACCTTACAGGG - Intergenic
914010191 1:143772235-143772257 AACCCAGATGCCACCTTACAGGG - Intergenic
914648813 1:149680894-149680916 AACCCAGATGCCACCTTACAGGG - Intergenic
919280381 1:195482327-195482349 ACCCAAGGTGGCACCTGCCAAGG - Intergenic
920750423 1:208669553-208669575 ACACCAGATGATAGCTGACAAGG - Intergenic
921099812 1:211919198-211919220 ACCCCATGTGCCACATGAGAAGG + Intergenic
921432096 1:215077610-215077632 AATCCAGATGCCACCTGACCTGG + Intronic
922972431 1:229754103-229754125 ACCCCAAATGCCACCTGCAGGGG + Intergenic
1063386160 10:5617449-5617471 ACCCCAGATGCCATGGGACAGGG + Intergenic
1064687922 10:17883792-17883814 GCCCCAGATGGCAGCTGCCATGG + Intronic
1067171097 10:43906626-43906648 ACCCCAGCTGACACTTGTCATGG + Intergenic
1067337802 10:45378889-45378911 ACTCCATCTGCCATCTGACAGGG - Intronic
1067919373 10:50437889-50437911 ACCCCAAATGCCCACTGACAAGG + Intronic
1068433838 10:56965928-56965950 ACCTCAGGTGCCACCTGCCTCGG - Intergenic
1068673729 10:59749093-59749115 ACCTCAGATGCCACCTCATCTGG + Intergenic
1069271483 10:66533460-66533482 ACCCTAGATGGAACCTGACCTGG - Intronic
1070805656 10:79269293-79269315 ATCCCACTTGCCACCTGCCAGGG + Intronic
1071493626 10:86153148-86153170 GTCCCAGATGCCACCTGACCTGG - Intronic
1072529614 10:96306670-96306692 GCCCCAGATGCCTGCTGCCAGGG + Intronic
1075622859 10:123940447-123940469 ACCCCAGAACCCACCTGGCAAGG + Intergenic
1075731468 10:124639127-124639149 ACCCAATGTGACACCTGACAGGG + Intronic
1078637957 11:13069448-13069470 ACTGCAGATGCCTCCTGCCAGGG + Intergenic
1082572694 11:54762453-54762475 AGCCCAGATGAAACCTGAGAAGG - Intergenic
1083172581 11:60931767-60931789 ACTCCAGCTGCCACGTGACGGGG - Exonic
1086451876 11:86925073-86925095 ACCCCAGACATCACTTGACAAGG + Intronic
1089130853 11:116210889-116210911 ATCCAAGCTGCCACCTGTCATGG + Intergenic
1089871970 11:121682973-121682995 ACCCCACATCCCACCTCACTAGG - Intergenic
1091043224 11:132301663-132301685 ACACCTGATGCAACCTGAGATGG + Intronic
1092628889 12:10357980-10358002 CCCCCATATGCCTCCTGACTGGG - Intergenic
1093562690 12:20561027-20561049 ACCTCAGGTGCCACCTGCCTCGG - Intronic
1096878523 12:54648616-54648638 ACCCCAGATGCAATCAGAGATGG - Intergenic
1098536182 12:71595773-71595795 ACCCAACATACCACCTGACATGG - Intergenic
1102818086 12:115885178-115885200 GCCCCAGATGCCACCTGGCCTGG + Intergenic
1104153999 12:126112950-126112972 AGACCAGATGCCCACTGACATGG + Intergenic
1104320998 12:127750623-127750645 CCCCCAGATCCCAACTGAGAAGG - Intergenic
1110306258 13:73990442-73990464 ACACCAAATGCCAGATGACAGGG + Intronic
1111799082 13:92960248-92960270 ACACCACATGCAAGCTGACAAGG + Intergenic
1112324333 13:98433386-98433408 AACACAGGTGCCTCCTGACATGG + Intronic
1113535752 13:111065040-111065062 AGCCCACATGGCACCTGGCATGG + Intergenic
1113889543 13:113728696-113728718 ACCGCAGATCCCACCTGTCTCGG - Intronic
1114194640 14:20466387-20466409 ACCACAGATGCCACCACACCTGG + Intergenic
1118106662 14:62667612-62667634 TCCCCAGGTGCCATCTGAAAGGG - Intergenic
1119181007 14:72605264-72605286 AGCCCAGATGCCAGCAGAGAGGG + Intergenic
1120565269 14:86047791-86047813 ACCCCCCATGCCTCCTGACTAGG - Intergenic
1122994459 14:105255392-105255414 ACCCCAGATGCCACCTGACACGG + Intronic
1125071397 15:35558105-35558127 ACCACAGATGCCACCATACCTGG - Intergenic
1127968057 15:63938658-63938680 ACCCCAGAAGCCTCCTTATAGGG - Intronic
1127974662 15:63988246-63988268 CCCCCAGGTGCCACCTCATAAGG + Intronic
1127983297 15:64049868-64049890 AACCCAGGTGCCATCTGCCATGG - Intronic
1128248181 15:66147255-66147277 TCCCCAAATGGCACCTTACATGG + Intronic
1129663579 15:77566934-77566956 AACCGGGATGACACCTGACATGG - Intergenic
1129720169 15:77873505-77873527 GCCCCAGCTGTCACCAGACAGGG - Intergenic
1130389886 15:83446402-83446424 ACCCCAGATGGGACCTGCTAAGG + Intergenic
1131235947 15:90697309-90697331 AGCACAAAAGCCACCTGACAGGG + Intergenic
1131931683 15:97449381-97449403 ACTCCAGTTCCCACCTGCCAAGG + Intergenic
1132243863 15:100279746-100279768 GACCCAGATTCCACCTGACTAGG + Intronic
1133391919 16:5417638-5417660 TCCCCAGATCCAACCTGAAAAGG - Intergenic
1139956977 16:70697834-70697856 GCCCCAGATGCCCCCAGACATGG + Intronic
1141803888 16:86329861-86329883 TCCCCATATGCCACCTGTAAGGG + Intergenic
1141858272 16:86699696-86699718 CCCACAGAGGCCACCTGTCAGGG - Intergenic
1142428606 16:90013841-90013863 TCCCCAGATGCCCCCTAAAATGG - Intronic
1143137822 17:4721592-4721614 CACCCAAAAGCCACCTGACACGG + Intergenic
1144851206 17:18244963-18244985 ACCCCTGAGGGCACCTGTCAGGG + Exonic
1146935884 17:36812560-36812582 CCCTCAGACACCACCTGACACGG + Intergenic
1150361026 17:64534279-64534301 GGCCCAGATGCCACCTCACAAGG - Intronic
1153472422 18:5461975-5461997 GCACCAGATGCCTCCTGCCAGGG + Intronic
1154307493 18:13241256-13241278 ACCTCACATGGCACCTCACAGGG + Intronic
1157961355 18:52157186-52157208 ACCTCAGAGGCCAACTGAGATGG - Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1163033272 19:14558105-14558127 TCCCCAGCTGCCATCTGACAGGG - Intronic
1163813476 19:19449107-19449129 CCCCCAGATGACACCAGAGAGGG + Intronic
1165486944 19:36101944-36101966 ACAGCAGACGCCACCTGAAATGG - Intronic
1165648740 19:37467778-37467800 ACCTCAGATGTCACTGGACAGGG - Intronic
1202706157 1_KI270713v1_random:25805-25827 AACCCAGATGCCACCTTACAGGG - Intergenic
925090430 2:1150825-1150847 ACCCCAGCTGCCTCCACACAGGG - Intronic
925611027 2:5703355-5703377 ACCCCAGATTCCTCCTCTCAGGG - Intergenic
928093944 2:28392769-28392791 ACCCCAGACTCCACCTTGCAGGG - Intronic
930792598 2:55350148-55350170 ACCTCAGATGCCACCCGCCTTGG + Intronic
931336547 2:61349875-61349897 ACCCCACAAAGCACCTGACATGG + Intronic
931749471 2:65317977-65317999 ACCCAGTATGCCACCTGATATGG + Intronic
933229975 2:79796057-79796079 ACACCAGATCCCAAGTGACAGGG + Intronic
933354583 2:81196358-81196380 AGCCCACAGGCCAGCTGACAGGG + Intergenic
933586196 2:84182019-84182041 ACCCCAGATGACAGCTAGCAAGG + Intergenic
937285090 2:120745619-120745641 GCCCCAGAAGCCACCCCACATGG - Intronic
938422387 2:131155414-131155436 TCCCCAGACCCCTCCTGACAGGG + Intronic
939161178 2:138591174-138591196 ATCTGAAATGCCACCTGACAAGG - Intergenic
939416099 2:141899326-141899348 ACAGCATATGCCACATGACAGGG - Intronic
942318120 2:174713026-174713048 ACCTCAGATACCACCAGGCAGGG + Intergenic
945077784 2:206057857-206057879 ACCAGTGATGCCATCTGACATGG + Intronic
948096955 2:235343213-235343235 ACCCCAGAAGCCATGTAACAGGG + Intergenic
948316751 2:237033054-237033076 ACCCCAGGGGCCAACTGAGAGGG - Intergenic
948585807 2:239018999-239019021 CCCCCAGATGCGGCTTGACAGGG - Intergenic
948631576 2:239306384-239306406 ACCTCAGAGGCCACCTGGCCAGG + Intronic
948704268 2:239779356-239779378 CCCCAAGATCCCAGCTGACATGG - Intronic
1169191061 20:3659672-3659694 AACCAAGATGCCTCCTGACAGGG + Intronic
1171727004 20:28633199-28633221 TTCCCAGAGGCTACCTGACATGG - Intergenic
1171791719 20:29532518-29532540 TTCCCAGAGGCTACCTGACACGG - Intergenic
1177468955 21:21529687-21529709 ATACCAGATGACATCTGACAGGG + Intronic
1178654417 21:34449806-34449828 ACCCAAGATGGCACATGCCATGG - Intergenic
1179373899 21:40832030-40832052 ATCACAGTTGCCACCTGACCAGG + Intronic
1179726103 21:43341929-43341951 ACCCCATGTGCCACCACACATGG - Intergenic
1180086500 21:45510089-45510111 GCCCCGCATGCCGCCTGACAGGG - Exonic
1180170771 21:46057082-46057104 ACCCCATCTGCCACCCGTCACGG - Intergenic
1180972738 22:19823969-19823991 CCCCCACATGCCACCTGCCTGGG + Intronic
1182052068 22:27320928-27320950 CACTCAGATGCCACCAGACATGG - Intergenic
1184704532 22:46201525-46201547 ACTCAAGGCGCCACCTGACACGG - Intronic
950223409 3:11213971-11213993 ACCTCAGATGCCACCCGCCAAGG - Intronic
950259722 3:11535261-11535283 ACCTCAGATGACACCAGGCAGGG - Intronic
950417704 3:12877656-12877678 ACCACAGATGCTCCCTGGCAGGG - Intergenic
953665029 3:44919259-44919281 ACACCATATGCCTCCTGATACGG + Intronic
954462300 3:50634260-50634282 AGCCCAGTTTCCACCTCACAGGG + Intronic
954954524 3:54507751-54507773 CACCCAGATCCAACCTGACAAGG + Intronic
956070156 3:65440430-65440452 GTCCAAGATACCACCTGACAGGG + Intronic
956278392 3:67528730-67528752 ACCCCAGATGCCACTGGTAATGG + Intronic
963497370 3:146083122-146083144 ATCCCAGCTGCCTCCTGAAAAGG + Intronic
963795511 3:149627331-149627353 ACCCCACATGACACCCTACATGG - Intronic
966314820 3:178633450-178633472 ACACCACATGGCACCTGCCAAGG + Intronic
967055912 3:185827999-185828021 TCACCAGAAGCCACCTGATAGGG - Intergenic
967567849 3:190992458-190992480 TACTCAGATGCCACCTTACAGGG - Intergenic
968686390 4:1962109-1962131 TCCCCAGGGGCCACCTGACAAGG - Intronic
972800887 4:42474624-42474646 CCCCCGAATGCCACCTCACACGG + Intronic
972906418 4:43753234-43753256 ACATCAAATGCCACCTAACAAGG + Intergenic
976943670 4:90738522-90738544 ACCCCTGTTGCCACCTCACTGGG + Intronic
979373254 4:119914462-119914484 ACACCACATGCAAGCTGACAAGG + Intergenic
981669174 4:147266986-147267008 TCCTCAGTTGACACCTGACATGG + Intergenic
984082737 4:175268696-175268718 ACCTCTGATGCCAACTAACATGG - Intergenic
985676251 5:1232715-1232737 AGCCCCGGGGCCACCTGACATGG + Intronic
989971949 5:50535614-50535636 AGCCCAGCTGACACCTGAGAGGG - Intergenic
994917980 5:106004329-106004351 GACCCCCATGCCACCTGACAGGG - Intergenic
997580289 5:135012666-135012688 ACCCCTGAAGCCACAGGACAGGG + Intergenic
997645668 5:135480185-135480207 ACCAAAAATGCCACCTGGCAAGG - Intergenic
1001385598 5:171335982-171336004 ACCCCAGATGCCAGGATACATGG + Intergenic
1001911307 5:175520754-175520776 AGCCCAGATGTCACCTGGCTAGG + Intronic
1002564130 5:180100443-180100465 ACCCCACCTGACACGTGACAAGG - Intergenic
1006169866 6:32086569-32086591 GGCCCAGATGCCACCTGACCTGG - Intronic
1007271042 6:40637303-40637325 AACCCAGATGCCATATGACTTGG - Intergenic
1008391396 6:50956253-50956275 ACCCCAGATGTCACTGGAAAAGG + Intergenic
1018709356 6:166486635-166486657 GCCCCCAATGCCACCTGGCAGGG - Intronic
1018713533 6:166514499-166514521 ACCCCAGCTGCCACCCTACAGGG - Intronic
1023718921 7:43073060-43073082 ACCCAAGGTGGCACCTGCCAAGG - Intergenic
1023882475 7:44328118-44328140 TCCCCAGCTGCCACCTGGGAGGG - Intronic
1024870579 7:53958708-53958730 ACCACATATGCCAACTTACATGG - Intergenic
1025613268 7:63096496-63096518 GCCCCAGATGCCCCCTCCCAAGG - Intergenic
1027297617 7:76793847-76793869 ACCCAGGATGCCACCTTACGTGG - Intergenic
1028991322 7:97051573-97051595 ACCCCCCATGCCTCCTGACTGGG + Intergenic
1032283592 7:130525112-130525134 ATCCCATATGCCACCTCAAATGG - Intronic
1032514877 7:132499484-132499506 ACCCCAGTGGCTACCTGTCAGGG + Intronic
1035016070 7:155767304-155767326 ACCACAGGTGGCACCTGACGGGG - Intronic
1036114231 8:5940981-5941003 ACCACAGATACCACCTGCAATGG + Intergenic
1036223631 8:6940766-6940788 ACCCCAAATGCCACCTGACCTGG - Intergenic
1037626781 8:20614998-20615020 AACCCAGATGCCACCTATCTTGG - Intergenic
1042188740 8:66164476-66164498 ACTGCAGAGGCCACCTGTCATGG + Intronic
1049090016 8:140507531-140507553 TACCCAGAAGCCAGCTGACAGGG + Intergenic
1049487606 8:142874711-142874733 TCCCCAGTTCCCACCTGACCCGG + Intronic
1049513130 8:143039705-143039727 ACCCCAGATGCCAAAGGACAAGG - Intronic
1052540411 9:29804498-29804520 ACTCCAGTTTCCACCTGAAAAGG - Intergenic
1053722742 9:40963896-40963918 TTCCCAGAGGCTACCTGACATGG + Intergenic
1054343223 9:63888102-63888124 TTCCCAGAGGCTACCTGACATGG - Intergenic
1055166629 9:73203297-73203319 AACCCAGCTGCCACTTGACAAGG - Intergenic
1057217211 9:93235754-93235776 TCTCCACATGCCACCTGACTGGG + Intronic
1057230899 9:93320737-93320759 CCCCCCGATGCCAGCTGGCACGG + Intronic
1059696553 9:116735418-116735440 TCACCAGAGGCCACCTCACAAGG - Intronic
1060174898 9:121490469-121490491 ACCACTGATGCCACCAGAGATGG - Intergenic
1061265863 9:129504716-129504738 TCCCCAGATACCTCCTGAGAGGG + Intergenic
1061547197 9:131311297-131311319 ACCTCAGATCCCAGATGACAGGG + Intergenic
1061680215 9:132239329-132239351 GCCCCAGAGGCCACCTCGCAGGG - Intronic
1062228162 9:135465594-135465616 ACCCCAGAGGTCACCTCAGACGG + Intergenic
1062488619 9:136793257-136793279 ACCCAAGTTTCCACCTGACCAGG + Exonic
1203452422 Un_GL000219v1:132081-132103 TTCCCAGAGGCTACCTGACATGG - Intergenic
1185854612 X:3522601-3522623 ACCACAGACACCACCTGACTAGG + Intergenic
1186633289 X:11374299-11374321 ACCCTAGAGCCCACCTGAGAGGG - Intronic
1186991016 X:15068052-15068074 AACCCAAATGCCCCCTGTCAGGG + Intergenic
1187491983 X:19760812-19760834 ACCCCACCTGCCAACAGACATGG + Intronic
1190382746 X:49855410-49855432 GCCCCAGCTGCCACCTGACTTGG - Intergenic
1198272177 X:135065326-135065348 CACCCAGATGCCACCTTATAGGG + Intergenic
1198286161 X:135194308-135194330 ACCCCAGAAGCCTCCTAATAGGG - Intergenic
1201476948 Y:14392358-14392380 AAGCCAGAGACCACCTGACATGG - Intergenic