ID: 1122994925

View in Genome Browser
Species Human (GRCh38)
Location 14:105257882-105257904
Sequence CTGGGGAAAGGCAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1502
Summary {0: 1, 1: 0, 2: 12, 3: 155, 4: 1334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122994910_1122994925 28 Left 1122994910 14:105257831-105257853 CCGGAAAAGGCAAAACTATGGAG 0: 9
1: 31
2: 133
3: 499
4: 1596
Right 1122994925 14:105257882-105257904 CTGGGGAAAGGCAGGGTGGGTGG 0: 1
1: 0
2: 12
3: 155
4: 1334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122994925 Original CRISPR CTGGGGAAAGGCAGGGTGGG TGG Intronic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900108465 1:996161-996183 CTGGGGAGGGGCAGGGATGGGGG + Intergenic
900122934 1:1056835-1056857 CTGGGGGGAGCCAGGGTGCGTGG + Intergenic
900136642 1:1120448-1120470 CTGGGGGAAGCAGGGGTGGGGGG + Intergenic
900179752 1:1305942-1305964 GGGGGGCCAGGCAGGGTGGGCGG - Intronic
900201737 1:1410869-1410891 TGTGGGAAAGGCAGGGAGGGCGG + Intergenic
900432927 1:2611463-2611485 CGGGGCAAGGTCAGGGTGGGTGG + Intronic
900485607 1:2921250-2921272 CACGGGAAAGGCAGGGGTGGGGG - Intergenic
900495652 1:2974847-2974869 TTGGGGACTGGCTGGGTGGGTGG + Intergenic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900833370 1:4980744-4980766 CTTGGGTAAGGCAGGGATGGGGG + Intergenic
900966815 1:5964575-5964597 CTGGGTACAGGCCGGGAGGGTGG - Intronic
900992984 1:6106547-6106569 CTGGGTGGAGGCTGGGTGGGGGG - Intronic
901012567 1:6209853-6209875 CGGGGGGTAGGCATGGTGGGAGG + Intronic
901155392 1:7134043-7134065 CTGGGGGGAGTCAGGGAGGGAGG - Intronic
901160432 1:7173034-7173056 CTGGGGACAGGCTGTGCGGGAGG + Intronic
901514551 1:9736242-9736264 CTGGAGAAAGGGAGAGTTGGGGG + Intronic
901629796 1:10642550-10642572 CTGGGCCCAGGCCGGGTGGGAGG + Intronic
901641169 1:10693983-10694005 CGGGGGACAAGCAGGGCGGGCGG - Intronic
901651140 1:10743843-10743865 TTGAGGAAAGGGAGGGAGGGAGG + Intronic
901671033 1:10856563-10856585 TTGGGGGCAGGCAGGGTGGCTGG - Intergenic
901721003 1:11197497-11197519 CTGGGGAAAGCCAGTGTGCTCGG - Intronic
901773177 1:11541411-11541433 CTCAGGGAAGGCAGGGAGGGTGG - Intergenic
902159952 1:14521742-14521764 CTGGGGAAAGGGAGGAAGTGTGG + Intergenic
902188896 1:14746640-14746662 CTGGGGTCAGGGAGGGAGGGTGG + Intronic
902329538 1:15724575-15724597 CTGGGGAGAAGCAGCCTGGGGGG + Intronic
902374948 1:16026280-16026302 CTGGGGCAGGGTAGGGTGGGCGG - Intronic
902534230 1:17110008-17110030 CTGGGGAATAGGAGGGTGTGGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902941858 1:19806082-19806104 CTGGGGAAAAACAGGGTGAAAGG - Intergenic
903131215 1:21280579-21280601 TTTGGGAAGGGCAGGGTGGAGGG + Intronic
903323352 1:22555588-22555610 CTGGGGACAGCCAGGGTGACAGG - Intergenic
903330606 1:22595204-22595226 CAGGGGAAAGCCAGGGTTGGGGG - Intronic
903335588 1:22622135-22622157 CTGGAGAAAGCCAGGGAGTGGGG + Intergenic
903339294 1:22643944-22643966 CTGGGGAATGAGAGGGTTGGGGG + Intronic
903369173 1:22824258-22824280 ATGGGGGAAGGAAGGGAGGGAGG + Intronic
903541070 1:24096632-24096654 CTGATGAGAGGCAGGGAGGGTGG + Intronic
903555838 1:24192717-24192739 CTGGGAAAAGGCAGGAGAGGAGG + Intergenic
903695965 1:25207195-25207217 CTCGGGAAAGGCAGGATGTTTGG + Intergenic
903741548 1:25561491-25561513 CTGGGGGAGGGCAGGGAGCGGGG + Intronic
903846194 1:26280940-26280962 CTGGGGGACGGGGGGGTGGGGGG + Intronic
903967203 1:27098392-27098414 CTGAGAAAAGGCCGGGTGGCTGG - Intergenic
903978218 1:27165897-27165919 CTTTGGAAAGCCAGGATGGGCGG + Intronic
903982900 1:27202799-27202821 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
904160960 1:28521700-28521722 CTGAGGGAAGGTGGGGTGGGTGG - Intronic
904267365 1:29325576-29325598 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904434784 1:30487339-30487361 CTGGGGCAGGACAGGATGGGAGG - Intergenic
904486154 1:30825554-30825576 CTGGGGAAAGTCAGGGCAGGGGG + Intergenic
904599281 1:31664887-31664909 GGGGGGAAAGGCAGGGAGGTAGG - Intronic
904625830 1:31801544-31801566 CTGGGGGAGGGCAGGCTGGGTGG + Intronic
905005010 1:34702666-34702688 CTTTGGAAAGCCAGGGCGGGTGG - Intergenic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905030912 1:34884160-34884182 CTTTGGAAGGCCAGGGTGGGTGG - Intronic
905142910 1:35862772-35862794 CTTTGGAAAGTCAAGGTGGGTGG + Intergenic
905182226 1:36174728-36174750 CCTGGGAGAGGGAGGGTGGGGGG - Intronic
905262499 1:36729684-36729706 TTGATGGAAGGCAGGGTGGGTGG + Intergenic
905292649 1:36933226-36933248 GTGGGGAATGGCAGGGGTGGGGG - Intronic
905328307 1:37174136-37174158 CTGGGGACTGGCAGGCAGGGGGG + Intergenic
905389938 1:37629807-37629829 CTGGGGACAGAGAGGGTGTGGGG + Exonic
905573001 1:39021101-39021123 CTTTGGGAAGGCAAGGTGGGTGG - Intergenic
905636822 1:39559559-39559581 CTGGGGGTGGGCAGAGTGGGCGG - Intergenic
905811278 1:40915304-40915326 TTGGGCAAAGGCAGGTTGAGGGG - Intergenic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906011299 1:42529228-42529250 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
906067592 1:42993318-42993340 CTGGGGCATGGCATGGTGCGCGG - Intergenic
906101876 1:43269221-43269243 CTGGTGAAGGGCAGGCTGGCTGG - Intronic
906107371 1:43302839-43302861 CTGAACAAAGGCAGGCTGGGGGG + Intronic
906165660 1:43684259-43684281 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
906207488 1:43994988-43995010 CTGAGGAAGGACAGGTTGGGTGG + Intronic
906274446 1:44505892-44505914 CTGGGGCAGGGCATGGGGGGAGG - Intronic
906282871 1:44566111-44566133 CTGGGGAAGGGCAAGCTAGGGGG - Intronic
906412290 1:45588345-45588367 CTTTGGAAAGGCAAGGTGAGTGG - Intronic
906479826 1:46192765-46192787 CTGGGCAAAGGTAGGATGGCAGG - Intronic
906511067 1:46410707-46410729 CTGGGGGGAGGCATGGAGGGAGG + Intronic
906856283 1:49308727-49308749 ATGAGAAAAGGCAGGGTGGAAGG + Intronic
907315270 1:53566616-53566638 CGGGGGAAGGGCCTGGTGGGAGG + Intronic
907459136 1:54594763-54594785 CTGGGCAGAGGCAGGAAGGGAGG + Intronic
907677906 1:56535698-56535720 CTTGGGGAAGGAAGGATGGGAGG + Intronic
907704462 1:56820454-56820476 TTGGGGATGGGCAGAGTGGGTGG + Intergenic
907834082 1:58092818-58092840 CTGAGGAATGGCACGGTGGATGG - Intronic
908862724 1:68507880-68507902 CAGGGGAAAAGCAGGCTGGAGGG + Intergenic
910269776 1:85381489-85381511 CTGGGGGAAGGTTGGGAGGGGGG - Intronic
911054162 1:93696563-93696585 ATGGAGAAGGGCAGGATGGGAGG - Intronic
911656211 1:100446940-100446962 CTTTGGAAAGACAAGGTGGGCGG - Intronic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
912308498 1:108595508-108595530 ATGGAGAAAGGGAGGGAGGGAGG + Intronic
912308513 1:108595569-108595591 GGGAGGAAAGGGAGGGTGGGAGG + Intronic
912495626 1:110089534-110089556 CTGGGGCAAGCCTGGGTGGCTGG + Intergenic
912982039 1:114383583-114383605 TTGGGGAAAGGGTGGGAGGGCGG + Intergenic
913229462 1:116729784-116729806 CTGGGGAAAGACAGTGAGCGAGG - Intergenic
913417701 1:118629965-118629987 CTGGGGAAAGGGTGGGAGTGGGG - Intergenic
913954924 1:143280877-143280899 AAGGGGAAAGGAAGGGAGGGAGG - Intergenic
914196103 1:145448850-145448872 CAGGGGAGAGGCTGGGAGGGTGG - Intergenic
914833685 1:151189969-151189991 CTGGGAAAAGGGAGGGGAGGAGG - Intronic
914901614 1:151714199-151714221 CTCTGGAAAGGCAGGCTGGGTGG - Intronic
915063384 1:153204977-153204999 CTGGGGGAGGGCAGGGAGGTGGG - Exonic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915442262 1:155952459-155952481 CCTGGGAAAGGCAGGGGAGGAGG - Intronic
915486574 1:156225445-156225467 GTGGGGAAAGGGTGGGAGGGGGG - Intronic
915597051 1:156901860-156901882 CTGGAGCAGGGCAGGGTGGGAGG + Intronic
915625521 1:157111862-157111884 CTGGGGGAGGGCAGGGGAGGAGG + Intergenic
915730115 1:158047392-158047414 CAGGGGAAGGTCAGGCTGGGTGG + Intronic
915731644 1:158058406-158058428 CTGGGGCAGGGCAGGGAGGGAGG - Intronic
915912228 1:159922438-159922460 CTTGGGGAAGGCAGGCGGGGTGG + Intronic
916097316 1:161362799-161362821 CTGGGGATGGGCCGGGTTGGGGG + Exonic
916445094 1:164864606-164864628 CTGGGGGAGGGAAGGGTGAGGGG + Intronic
917429658 1:174952831-174952853 CTGTGGGAAGTCAAGGTGGGTGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
917931382 1:179824919-179824941 GAGGGGCCAGGCAGGGTGGGAGG - Intergenic
917996031 1:180439294-180439316 CTGGGGAGGGGCCGGGTGTGGGG + Intronic
918361821 1:183766970-183766992 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
918760696 1:188401785-188401807 GTGGGGAAAGGGAGGGTGAGGGG + Intergenic
919727443 1:200893538-200893560 CTGGGGAAGGGCAGGGCTGCAGG + Intronic
919878202 1:201885825-201885847 GTGGGGAAAGGCAGGAGGAGGGG - Intergenic
919980214 1:202638245-202638267 CTGGGGAGGGGCTGGGGGGGAGG - Intronic
920097371 1:203495273-203495295 CTTTGGGAAGCCAGGGTGGGTGG + Intronic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
920365944 1:205448492-205448514 CTGGAGGGAGGCAGTGTGGGTGG - Intronic
920838709 1:209535761-209535783 CTGGGGAAAGACGGGGAGGGAGG + Intergenic
920854134 1:209649921-209649943 CTGGAGGAAGGCGGGATGGGAGG - Intronic
921123001 1:212152945-212152967 CTGAGGAAAGGCATGAAGGGAGG + Intergenic
921173116 1:212566515-212566537 GTGGGGTAAGGCAGGCTGAGGGG + Intronic
921233298 1:213096443-213096465 CTTTGGGAGGGCAGGGTGGGTGG + Intronic
921917996 1:220634387-220634409 CTGGGGTAGGGCAGGGGTGGGGG - Intronic
922021648 1:221710935-221710957 GTGAGGCAAGGCGGGGTGGGGGG + Intronic
922310109 1:224380855-224380877 CTTTGGAAAGACAAGGTGGGAGG + Intergenic
922322610 1:224501952-224501974 CTGGAGGAAGGTAGGGTGGAGGG + Intronic
922420793 1:225460105-225460127 CGGGGTAAAGGCAAGGCGGGTGG + Intergenic
922436048 1:225607726-225607748 TTGGGGAAAAGGAGGGTGGTGGG - Intronic
922447027 1:225706323-225706345 CTTGGGGAGGCCAGGGTGGGCGG + Intergenic
922522137 1:226263826-226263848 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
922756125 1:228097829-228097851 CTGGGGGAAGGAAGGGTTGGTGG - Intronic
922768966 1:228171665-228171687 CTGGGGCAAGGCAGGCAGGGTGG - Intronic
922803253 1:228373550-228373572 CTGGGGTAAGGTAGGGTCTGGGG - Intronic
923188425 1:231596497-231596519 GTGGGGAAAAGCAGCCTGGGGGG + Intronic
923263886 1:232293982-232294004 TAGGGGAAAGGCAGGGAGGGGGG - Intergenic
923276458 1:232401005-232401027 CTGGGGAATGGCTGGGTTGGAGG - Intronic
923625165 1:235607778-235607800 CCGGAGAGAGGCAGGGAGGGTGG - Intronic
923741404 1:236658225-236658247 CTTTGGGAAGCCAGGGTGGGAGG + Intergenic
924708936 1:246518779-246518801 CAGGGAAAAAGCAGGGTGTGTGG - Intergenic
1062801966 10:387580-387602 GTGTGGACAGGCAGGGTGGGAGG + Intronic
1062987820 10:1785656-1785678 CTGGAGGAGGGCGGGGTGGGGGG + Intergenic
1063022967 10:2147644-2147666 CTGGGGACAGGCATGAGGGGTGG - Intergenic
1063141813 10:3262579-3262601 CTGGGGAAGGCCATGGAGGGAGG - Intergenic
1063423052 10:5928995-5929017 CAGGGTGCAGGCAGGGTGGGCGG + Intronic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1064243696 10:13652935-13652957 GTGGGGAAAGACAGGGTTTGGGG + Intronic
1064418339 10:15168977-15168999 GTGGGGAAAGGCGGGGCTGGAGG - Intergenic
1064440035 10:15345508-15345530 CTGTATAAAGGCAGGGTGGCCGG + Intronic
1065168593 10:23005917-23005939 CTGGGCAGAGGGAGGGTGAGGGG + Intronic
1065272247 10:24046676-24046698 CAGGGGAAGTGCATGGTGGGAGG - Intronic
1065290399 10:24223839-24223861 CTGGGGGTGGGCGGGGTGGGTGG - Intronic
1065462915 10:25988206-25988228 CGGGGGAAAGTGTGGGTGGGTGG + Intronic
1065552021 10:26877613-26877635 CTTTGGAAAGCCAGGGAGGGAGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065736197 10:28754777-28754799 CTGGTGAAGGGCAGGGAAGGAGG + Intergenic
1065951636 10:30657771-30657793 ATGGAGAAAGGGAGGGAGGGAGG - Intergenic
1066099711 10:32106843-32106865 ATGGGGAAAGGCAGGCTGGTAGG + Intergenic
1066489890 10:35884277-35884299 CTGTGGGAAGGATGGGTGGGAGG - Intergenic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1067127700 10:43533930-43533952 CAGGGGAGGGGCCGGGTGGGAGG + Intergenic
1067161104 10:43825809-43825831 GTGGGGAAAGTCCGGGTGGCAGG - Intergenic
1067214873 10:44293410-44293432 GTGGGGAAAGTCCGGGTGGCAGG + Exonic
1067355672 10:45523280-45523302 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1068685205 10:59863546-59863568 TTGGGGCAGGGAAGGGTGGGTGG + Intronic
1068748165 10:60559259-60559281 CTGGGGAAAGGGTTGGGGGGTGG - Intronic
1068979605 10:63048204-63048226 CTTTGGGAAGGCAAGGTGGGAGG + Intergenic
1069117706 10:64528483-64528505 CAGGAGGAAGGCGGGGTGGGAGG - Intergenic
1069457125 10:68561691-68561713 CGGGGGAGAGGGAGGGAGGGAGG - Intronic
1069495365 10:68898916-68898938 CTTTGGGAAGCCAGGGTGGGCGG - Intergenic
1069513535 10:69059537-69059559 CTTTGGAAGGCCAGGGTGGGAGG - Intergenic
1069563794 10:69450172-69450194 CTGAGAAAAGGCCAGGTGGGAGG + Intergenic
1069587853 10:69620584-69620606 CAGGGGAAAGGCAGGAGGAGGGG - Intergenic
1069607532 10:69749218-69749240 CTGGGGAATGGAGGGGTGGGGGG - Intergenic
1069707610 10:70468597-70468619 GTGGGCAAAGGCAGGGAAGGGGG - Intergenic
1069800510 10:71078843-71078865 CTGGGGACAGGTGGGGTTGGAGG - Intergenic
1069838375 10:71323825-71323847 CTGGGCAACGGCAGAATGGGAGG + Intronic
1069875919 10:71562725-71562747 CCTGGGACAGCCAGGGTGGGAGG + Intronic
1069895338 10:71677047-71677069 CTGGTGAAGGGCAGGGTGGTTGG - Intronic
1069962456 10:72087152-72087174 CAGGGGTGAGGCAGGGCGGGCGG - Intronic
1070029345 10:72662067-72662089 CTTCGGAAAGCCAAGGTGGGTGG - Intergenic
1070085719 10:73235354-73235376 TTGGGGAAAGAAAAGGTGGGGGG + Intronic
1070105230 10:73425277-73425299 CTGGGGATAAGCAAGGTGAGGGG - Intronic
1070367623 10:75751352-75751374 CTGGGGAGAGGGAGGGGGAGTGG + Intronic
1070595566 10:77830551-77830573 CTGGGGAAGGGCAGGGTCCTCGG - Intronic
1070743748 10:78920041-78920063 CTGGGAAGAGGCAGGGAGGGAGG + Intergenic
1070911569 10:80123434-80123456 CTGGGGGAAGAGAGTGTGGGAGG + Intergenic
1071374485 10:84988708-84988730 CTGGGGAAGGGAAGGGGCGGGGG - Intergenic
1071481601 10:86069069-86069091 CTGGGGAAGGTTAGGTTGGGAGG + Intronic
1071599024 10:86947340-86947362 GTTGGGAAAGGCAGGGGCGGGGG + Intronic
1071890632 10:90002801-90002823 CTGGGGAGGGGCCGAGTGGGGGG + Intergenic
1072063890 10:91846370-91846392 CTGGGATGAGGCAGTGTGGGAGG - Intronic
1072230357 10:93409157-93409179 CTGGGAAAGGGCAGGGCAGGTGG + Intronic
1072598284 10:96896665-96896687 CTTTGGAAGGGCAGGGCGGGTGG - Intronic
1072967169 10:99983628-99983650 CTGGGGGCACGCAGGGTAGGAGG - Intronic
1073099263 10:100998406-100998428 CTGGGGTGAGTCAGGGTGGCTGG + Intronic
1073111823 10:101067123-101067145 CCGGGGGAAGGCAGGGGAGGGGG + Intronic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073180985 10:101583045-101583067 CTTGGGAAAGGCAGGGAGCATGG + Intronic
1073329465 10:102661137-102661159 TTGGGGGAAGGCAGGAGGGGAGG - Intergenic
1073466059 10:103695087-103695109 CTGGGGAAGGGCAGGGAGTGAGG + Intronic
1073564392 10:104522655-104522677 ATGGGGCAGGGCAGGGTGGCGGG + Intergenic
1074033377 10:109712030-109712052 CGGGGGAAAGGAGGGGTGGGGGG - Intergenic
1074544899 10:114394750-114394772 CTGGGGCAAAGCAGGAAGGGTGG - Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074829452 10:117238674-117238696 AAGGGGAAAGGGAGGGAGGGGGG - Intergenic
1074898904 10:117800283-117800305 CTTGGGAAATGCTGGGGGGGGGG - Intergenic
1075276703 10:121100178-121100200 CTCAGGAAAGGAAGTGTGGGTGG + Intergenic
1075380845 10:122017370-122017392 CTGAGGACTGGCAGGGAGGGAGG - Intronic
1075719116 10:124574738-124574760 CTGGGGGAGGGCATGGTCGGAGG + Intronic
1076181509 10:128412587-128412609 CAGGGAAAAGCCAGGGAGGGTGG - Intergenic
1076280926 10:129245040-129245062 CTGGGGAAGATCGGGGTGGGTGG - Intergenic
1076391929 10:130110074-130110096 CCGGGGGTAGGCAGGATGGGAGG - Intergenic
1076535565 10:131174529-131174551 CTGGGGAACGGGCGGGTGAGAGG - Intronic
1076679954 10:132166703-132166725 CTGGGGACACGCTGGGTGTGGGG + Intronic
1076791783 10:132780684-132780706 CAGGGGCCAGGCAGGGCGGGTGG + Intronic
1076886655 10:133266187-133266209 CTGAGGAAAGGCAGAGGGGCCGG + Intronic
1076893639 10:133297801-133297823 CTGAGGAAAGGCAGGCCCGGGGG + Intronic
1077044513 11:538422-538444 CTGGAGAAAGGCAGGCAGTGGGG + Intronic
1077065957 11:640997-641019 ATGGGGAGAGGCGGGGTGGGGGG + Intergenic
1077078018 11:709948-709970 CTGGGGAAGGGCAGAGTGGGGGG - Intronic
1077249679 11:1555472-1555494 CTGGGGCATGGCTGGGAGGGGGG + Exonic
1077281107 11:1746684-1746706 CTGGGCAGAGGCTGGCTGGGAGG - Intronic
1077360882 11:2139614-2139636 CGGGGGCGAGGCTGGGTGGGGGG + Intronic
1077383859 11:2259915-2259937 CTGGGGGATGGCAGGGGGGCGGG + Intergenic
1077563064 11:3277455-3277477 CTGGGGAGTTGCGGGGTGGGGGG - Intergenic
1077568955 11:3323271-3323293 CTGGGGAGTTGCGGGGTGGGGGG - Intergenic
1078102802 11:8339698-8339720 CTAGGGCAAGGGTGGGTGGGAGG + Intergenic
1078120648 11:8505472-8505494 CTGGGCAAGGGCAGGATGGTAGG - Intronic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078542134 11:12221259-12221281 GTGGGCAAAGGCATGGTGGTTGG - Intronic
1078572989 11:12475531-12475553 AGGAGGAAAGGAAGGGTGGGTGG + Intronic
1078809634 11:14745732-14745754 ATGGGCACAGGCAGGGAGGGTGG - Intronic
1078851364 11:15167183-15167205 CTGGGAGAAGTCAGGCTGGGTGG + Intronic
1079114726 11:17634041-17634063 GAGGGGAATGGCAGGGTGCGAGG - Intronic
1079133534 11:17763270-17763292 AAGGTGATAGGCAGGGTGGGGGG - Intronic
1079452121 11:20606333-20606355 CTGGAGAAAGGTACTGTGGGAGG + Intronic
1079582787 11:22087289-22087311 CTGATGAAATGCAGGGTGTGTGG - Intergenic
1079836639 11:25342810-25342832 CTGTGGGAAGCCAAGGTGGGTGG + Intergenic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1080884231 11:36350686-36350708 CGGGGGAAAGGGTGGGAGGGTGG - Intronic
1081149426 11:39608466-39608488 CAGGGTAAAGGTTGGGTGGGTGG + Intergenic
1081602740 11:44506475-44506497 CAGGGAAGAGGCAGGGTGGATGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081867492 11:46367567-46367589 CTTGGGAGAGGGCGGGTGGGCGG + Intronic
1081952886 11:47060643-47060665 CCGGGGAAAGGATGGGTTGGGGG + Intronic
1082054605 11:47803072-47803094 CTGGGGGAGGCCAAGGTGGGAGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082787746 11:57326184-57326206 TTGGGGAGAGATAGGGTGGGAGG - Exonic
1082811739 11:57482720-57482742 CTGGGAAAAGACGGGGAGGGGGG + Intergenic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083659113 11:64244035-64244057 CTGGGGAGGGGCAGGGGGAGAGG + Exonic
1083659648 11:64246188-64246210 CTGGGGAGTGGCATGATGGGGGG + Intronic
1083699271 11:64464380-64464402 GAGGGGAAAGGCAGGCTGGCAGG + Intergenic
1083742315 11:64717427-64717449 GTGGGTAGGGGCAGGGTGGGAGG - Intronic
1083826727 11:65208126-65208148 TTGGGGCATGGCAGGTTGGGAGG + Intronic
1083872423 11:65497452-65497474 CTGGGGAATGGCATGGGGGCGGG - Intergenic
1084117308 11:67049799-67049821 CCGGGGAAGGCCAGGGTGGAAGG + Exonic
1084120436 11:67065993-67066015 CAGGGGTGGGGCAGGGTGGGAGG + Intronic
1084174354 11:67415786-67415808 CCGGGGAGAGCCAGGGAGGGGGG + Intronic
1084197113 11:67529735-67529757 CTTTGGAAGGCCAGGGTGGGCGG + Intergenic
1084494691 11:69497183-69497205 CTGGGGCAGGGCGGGGCGGGGGG - Intergenic
1084537278 11:69764560-69764582 CTGGGGGAGGGGTGGGTGGGGGG + Intergenic
1084679475 11:70658120-70658142 CGTGTGACAGGCAGGGTGGGGGG - Intronic
1084779626 11:71399775-71399797 CTGGGGGAGGGCAGTGTGGAGGG + Intergenic
1084791653 11:71478694-71478716 CTGGGGACAGGCAGGCAGAGAGG + Intronic
1084870593 11:72096243-72096265 CTGGGGGAAGCCGAGGTGGGTGG - Intronic
1085245850 11:75099665-75099687 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085245883 11:75099738-75099760 GTGGGGGAAGGGAGGGAGGGAGG + Intergenic
1085336140 11:75697940-75697962 CTTTGGGAAGGCAAGGTGGGGGG - Intergenic
1086154312 11:83648822-83648844 TTGGGAAAAGGCAGGGTGGAAGG + Intronic
1086732769 11:90270657-90270679 CTGGGGAAAGGGGCGGTTGGGGG - Intergenic
1086761116 11:90632839-90632861 CAGGAGAATGGCAGGGTGGTGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087629133 11:100629940-100629962 CTGGGGACAGGCTGGGTCAGAGG - Intergenic
1088031946 11:105262049-105262071 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1088280389 11:108129032-108129054 CAGGGGAAAGGCGGGGGGTGGGG - Intronic
1088325080 11:108593161-108593183 CTGGGGTCGGGCAGGGTGGGGGG - Intronic
1088544508 11:110946127-110946149 ATGGGGAGAGACAGGGAGGGAGG - Intergenic
1088788505 11:113203632-113203654 CTGGGGAAAGGAAGAATGGGTGG + Intronic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089018854 11:115190401-115190423 GTGGGGAAGGGCAGGGAGGAGGG - Intronic
1089052812 11:115560619-115560641 CTTTGGGAAGGCAAGGTGGGTGG + Intergenic
1089146836 11:116335431-116335453 ATGGGGGCAGGAAGGGTGGGGGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089414484 11:118275835-118275857 CTGGGGGAGGCCAAGGTGGGAGG - Intergenic
1089520573 11:119059931-119059953 CTGGGGAAAGGGGGAGGGGGAGG + Intergenic
1089542084 11:119195406-119195428 CTGGGGTGAGTCATGGTGGGTGG - Exonic
1089561108 11:119343623-119343645 CTGGGGACAGGGAGAGTGTGGGG + Intronic
1089642745 11:119858499-119858521 TAGGGGAGAGGCAGGGAGGGAGG + Intergenic
1089699587 11:120236395-120236417 GTGGGGTAAGGGAGGGAGGGAGG + Intergenic
1089833850 11:121352725-121352747 TTGGGGAAAGGCTGGTTGGCAGG - Intergenic
1090118555 11:124000659-124000681 CTGGGGGAAGGAAGGAAGGGAGG + Intergenic
1090604562 11:128407761-128407783 CTGGGGTAAGACATGGTGAGAGG - Intergenic
1090901684 11:131037723-131037745 ATAGGGAAGGGCTGGGTGGGAGG + Intergenic
1091110595 11:132962897-132962919 CTGGGGGAAGGCAGGCTGGTGGG - Intronic
1091218751 11:133918707-133918729 CTGGTGGAAGGCAGGATGGGAGG - Intronic
1091230937 11:133987538-133987560 ATCGGGAGAGGCTGGGTGGGGGG + Intergenic
1091358064 11:134953608-134953630 CCAGGGAAAGGCATGGTGTGGGG - Intergenic
1091358075 11:134953654-134953676 CCAGGGAAAGGCATGGTGTGGGG - Intergenic
1091358086 11:134953700-134953722 CCAGGGAAAGGCATGGTGTGGGG - Intergenic
1091628444 12:2140215-2140237 CTGGGAACAGTCACGGTGGGTGG + Intronic
1091660955 12:2383228-2383250 CTCAGGAAAAGAAGGGTGGGTGG + Intronic
1091700175 12:2653931-2653953 CTGGGGAGAGACAGAGCGGGAGG - Intronic
1091752807 12:3033177-3033199 CAGGGGACAGGCAGGGAGGCTGG - Intronic
1091798705 12:3311315-3311337 CTGGGTAAATGCAGGGTAGCGGG - Intergenic
1091916120 12:4272746-4272768 CCGGGGAAAGGAAGGGGTGGTGG + Intergenic
1092194649 12:6541913-6541935 GTGAGGAAAGTCAGTGTGGGCGG + Intronic
1092269019 12:7007292-7007314 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1092475888 12:8818823-8818845 CTTTGGGAAGGCAAGGTGGGAGG - Intergenic
1092607526 12:10136623-10136645 CTTTGGGAAGCCAGGGTGGGAGG + Intergenic
1093284467 12:17241422-17241444 CTGGGAAAAGGGTGGGAGGGGGG - Intergenic
1094623989 12:32106289-32106311 CTTGGGAGAGGCAGGGAGAGAGG + Intergenic
1095466702 12:42495123-42495145 CTTTGGAAAGTTAGGGTGGGTGG + Intronic
1095527234 12:43141527-43141549 CTGGGCAAGGGCAGAGTGGCAGG + Intergenic
1095536095 12:43249445-43249467 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1096116591 12:49059067-49059089 CTGGGCAAAGGGAGAGTGTGTGG - Intronic
1096230583 12:49894652-49894674 CTGGGGAAAGGCATTGTGTTTGG - Intronic
1096242747 12:49968023-49968045 CTGGGGAGAGGAAGAGAGGGAGG - Intronic
1096344279 12:50831547-50831569 TTTTGGAAAGCCAGGGTGGGTGG - Intergenic
1096348519 12:50873182-50873204 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1096625486 12:52892873-52892895 GTCGGGAAAGGCAGGGTGGAGGG + Intergenic
1096681085 12:53255674-53255696 CTGGTGGAATGCAGGGTGGAAGG + Intergenic
1096861591 12:54532639-54532661 CTGAGGGCAGGCAGGGTGGGTGG - Intronic
1096995345 12:55834775-55834797 ATGGGGATGGTCAGGGTGGGAGG + Intergenic
1097225923 12:57476753-57476775 CTGGGGGAGGGCTGGGTAGGAGG + Intronic
1097232913 12:57523031-57523053 AGGGGGAGGGGCAGGGTGGGGGG - Intronic
1097261092 12:57720691-57720713 CTGGGGGAAGGCAGGGAATGAGG - Intronic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1098572674 12:72006514-72006536 CTGGGGAAAGGTAGGGGATGAGG + Intronic
1098682304 12:73371268-73371290 CTGGCCAAAGGCAGGGGAGGAGG - Intergenic
1098731083 12:74037613-74037635 CTGGGGGAGAGAAGGGTGGGTGG - Intergenic
1098740467 12:74167697-74167719 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1098897690 12:76083139-76083161 CTGGGGGATGGCAGTGTAGGGGG - Intronic
1099192709 12:79576163-79576185 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1099243036 12:80161076-80161098 CGGGGGAAAGGCTGGGAAGGGGG + Intergenic
1099575843 12:84380795-84380817 CTTGGGAAAGGGTGGGTCGGGGG - Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1101076959 12:101140301-101140323 CAGGGGGAAGGAAAGGTGGGTGG - Intergenic
1101502577 12:105317709-105317731 CTGGAGAAACTCAAGGTGGGTGG + Intronic
1101828156 12:108236856-108236878 ATGGGGAGAGGCAGGGAGAGGGG - Intronic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1101967297 12:109290404-109290426 CTGGGGACGGGCAGGTTGGAGGG - Intronic
1101988848 12:109468228-109468250 CTGGGGAAGGCCAGGGTGTGGGG - Intronic
1102161435 12:110772169-110772191 CTGTGGGAAGCCAAGGTGGGTGG + Intergenic
1102184405 12:110936491-110936513 CGGGGGAAGGGCCTGGTGGGAGG + Intergenic
1102445938 12:113002831-113002853 GTTGGGAGAGGCAGGGTAGGGGG + Intronic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102742879 12:115223568-115223590 CTGGGGGAAGCCAGGGGGTGAGG + Intergenic
1103180684 12:118908736-118908758 CTCGGGGAAGGCAGGGTAGGAGG + Intergenic
1103446979 12:121000996-121001018 CTAGGGACAGGCAGGTGGGGTGG + Intronic
1103581339 12:121917916-121917938 CTGGGGCATGGCAGTGTGGGCGG + Exonic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103725372 12:122995131-122995153 GTGGGGAATGGCAGAGTTGGGGG - Intronic
1103766505 12:123283967-123283989 CTGTGGGAGGGCAAGGTGGGTGG - Intergenic
1103842865 12:123879471-123879493 ATGGGGCAAAGGAGGGTGGGTGG + Intronic
1103949801 12:124544519-124544541 CTGGGGATATTCAGGGTGGGAGG + Intronic
1104573792 12:129948473-129948495 CTTGGGAAAGGCCTAGTGGGAGG - Intergenic
1104748649 12:131224740-131224762 CTGGGGGAAGCCAGGATGGAGGG + Intergenic
1104784474 12:131440824-131440846 CTGGGGGAAGCCAGGATGGAGGG - Intergenic
1104823628 12:131693347-131693369 CTGGGGAGGGCCAGGGAGGGAGG - Intergenic
1104885327 12:132104126-132104148 CTGGGGGATGGCAGTGTGAGGGG - Exonic
1105007300 12:132729450-132729472 GAGGGGAATGGGAGGGTGGGAGG + Intronic
1105508266 13:21029851-21029873 CTTTGGGAAGCCAGGGTGGGTGG + Intronic
1106031664 13:26010474-26010496 CTGGGGCCAGGCAGGGTGAGGGG + Intronic
1106080766 13:26498632-26498654 CTAGCGCAAGGCAGGGTTGGAGG + Intergenic
1106226517 13:27790664-27790686 CTGGGCAGAGGCAGGCTGGAGGG - Intergenic
1106954261 13:34918296-34918318 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1107438492 13:40403309-40403331 CTGGGACCAGGAAGGGTGGGAGG - Intergenic
1107530749 13:41280176-41280198 CTTTGGGAAGCCAGGGTGGGCGG - Intergenic
1107809479 13:44186473-44186495 CTTGGGAGAGGCAGCGTGGTTGG - Intergenic
1108090922 13:46849106-46849128 CTGGGATAAGGAAAGGTGGGGGG - Intronic
1108385555 13:49896219-49896241 CTGTGGAAGGTCAAGGTGGGTGG + Intergenic
1109024345 13:57140542-57140564 GTTGGGAGAGGCAGGGAGGGAGG - Intergenic
1109025332 13:57147112-57147134 GTTGGGAGAGGCAGGGAGGGAGG - Intronic
1109026322 13:57153685-57153707 GTTGGGAGAGGCAGGGAGGGAGG - Intronic
1109027314 13:57160256-57160278 GTTGGGAGAGGCAGGGAGGGAGG - Intergenic
1109028300 13:57166821-57166843 GTTGGGAGAGGCAGGGAGGGAGG - Intergenic
1109029287 13:57173392-57173414 GTTGGGAGAGGCAGGGAGGGAGG - Intergenic
1109161918 13:58986033-58986055 GTGATGAAGGGCAGGGTGGGTGG - Intergenic
1110139257 13:72107187-72107209 CTGGGGAAAGGATGGGAGGTGGG - Intergenic
1110147150 13:72205461-72205483 CTTGAGTAAGGCCGGGTGGGAGG + Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110240692 13:73263031-73263053 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1111177665 13:84618157-84618179 CTGGGGCCTGTCAGGGTGGGGGG - Intergenic
1111291203 13:86172182-86172204 CTGGTGGAATGCAGGGTGGGAGG - Intergenic
1111775801 13:92659891-92659913 CTGTGGCAAGGCAGAGTGGGAGG + Intronic
1112154765 13:96805204-96805226 CGGGGGAAGGGCCTGGTGGGAGG + Intronic
1112373280 13:98814693-98814715 CTTTGGGAAGGCATGGTGGGTGG + Intronic
1112512057 13:100018769-100018791 CAGAGGAAGGGCTGGGTGGGAGG + Intergenic
1112538800 13:100285956-100285978 GTGGGGAGAGGGAGGGTGAGAGG - Intronic
1112582126 13:100685347-100685369 TCGGGGAAAGGCTGGGAGGGGGG + Intergenic
1112819185 13:103310998-103311020 CTGGGGAAAGAAAGGGGGAGGGG + Intergenic
1112835953 13:103514310-103514332 CGGGGGATAGGCAGGGAGAGAGG - Intergenic
1113191993 13:107759449-107759471 CTGTGGGAAGGCGAGGTGGGTGG - Intronic
1113235466 13:108268206-108268228 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1113361994 13:109640287-109640309 CTGGGGATGGGCTGGGTGTGAGG - Intergenic
1113945630 13:114042630-114042652 CTGGCGTGAGGCAGGGTGGCCGG - Intronic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114122667 14:19687495-19687517 AGGGGGAAAGGGAGGGAGGGAGG - Intergenic
1114326153 14:21590785-21590807 CTGTGGAAAGTCAAGATGGGTGG + Intergenic
1114531616 14:23400071-23400093 CCTGGGAAAGGAAGAGTGGGGGG + Intronic
1114633506 14:24174225-24174247 CTTTGGAAAGCCAGGGTGGGTGG - Intronic
1114652209 14:24292415-24292437 CCTGGGAAGGACAGGGTGGGTGG - Intronic
1114662174 14:24354074-24354096 CTGGGGAGAAGCAGGGATGGAGG + Intergenic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1116085174 14:40228018-40228040 CTGGAGAGTGGCAGGGTGGGAGG - Intergenic
1116687478 14:48058698-48058720 GTGGTTACAGGCAGGGTGGGAGG + Intergenic
1116786203 14:49291482-49291504 CAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1117342194 14:54802045-54802067 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1117427695 14:55618637-55618659 CTTGGGAAAATAAGGGTGGGTGG + Intronic
1117993651 14:61458870-61458892 TTGGGGAAGGGCCTGGTGGGAGG - Intronic
1117996033 14:61479175-61479197 GTGGAGAAAGACTGGGTGGGTGG - Intronic
1118006424 14:61568118-61568140 CTGCAGGAAGGCAGGGTGGCCGG - Intronic
1118550614 14:66945466-66945488 CTGGGGGAAGAAAGTGTGGGAGG + Intronic
1118576795 14:67250186-67250208 CTGGAGGAAGGAAGAGTGGGTGG - Intronic
1118707807 14:68496042-68496064 CTGGGGGAAGGCAGGATGGAAGG - Intronic
1118730564 14:68663055-68663077 CTGTGGGAAGCCAAGGTGGGTGG + Intronic
1118797033 14:69153045-69153067 CGGGGGGAGGGCCGGGTGGGGGG - Exonic
1119027326 14:71164435-71164457 CTGGTGGGAGGCGGGGTGGGGGG + Intergenic
1119182625 14:72614911-72614933 CCTGGGGAAGGGAGGGTGGGAGG - Intergenic
1120160631 14:81141261-81141283 CTGGACAAGGGCTGGGTGGGAGG + Intronic
1120237466 14:81909088-81909110 CTGCAGAGAGGAAGGGTGGGAGG + Intergenic
1120287664 14:82524849-82524871 CAGGGGAAAGGGTGGGAGGGTGG + Intergenic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121109532 14:91303227-91303249 CGGGGGAGAGGCAGGGTGTGTGG - Intronic
1121171103 14:91855102-91855124 CAGGGGAAAGGAAGGATGGGTGG + Intronic
1121199664 14:92106624-92106646 CCGGGGAGGGGCGGGGTGGGCGG - Intergenic
1121562741 14:94886971-94886993 CTGGGCAAAGGCAGGGGCTGTGG + Intergenic
1121902447 14:97706332-97706354 CTGGGAAAAAGCAGGGAGGCTGG + Intergenic
1122120185 14:99549027-99549049 CTGGGAAAAGTCGGGGAGGGAGG + Intronic
1122128711 14:99592964-99592986 CTGGAGAAAGGGTGGCTGGGTGG + Intronic
1122228943 14:100295518-100295540 CAGGGGACAGGGAGGGTGTGAGG - Intronic
1122378325 14:101283963-101283985 CTGTGGGAAGCCAAGGTGGGTGG - Intergenic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122664200 14:103317393-103317415 CCTGGGAGAGTCAGGGTGGGTGG - Intergenic
1122707236 14:103629093-103629115 CTGGGGAAACTGAGGCTGGGTGG - Intronic
1122754767 14:103969813-103969835 CTGGGGTGGGGCGGGGTGGGGGG + Intronic
1122774926 14:104112917-104112939 CTGGGCAAAGGCAGGGTGGCAGG - Exonic
1122781132 14:104144002-104144024 CTGGGGAAGGGCCGGGAGGGAGG + Intronic
1122879016 14:104681746-104681768 CACTGGAGAGGCAGGGTGGGCGG + Intergenic
1122970373 14:105149917-105149939 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1122970399 14:105149969-105149991 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1122970421 14:105150020-105150042 GTGGGGGGAGGCAGGGTTGGGGG + Intronic
1122994925 14:105257882-105257904 CTGGGGAAAGGCAGGGTGGGTGG + Intronic
1123018256 14:105385737-105385759 CTGGGGACAGACAGGGTGGGAGG - Intronic
1202937460 14_KI270725v1_random:104408-104430 ATGAGGAAAGGAAGGGAGGGAGG - Intergenic
1124109540 15:26773210-26773232 GTGGGGGAGGGCAGGGTGCGCGG - Intronic
1124368834 15:29091841-29091863 CTGGGGAAGTGCAGGATGGCTGG + Intronic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1124969581 15:34473190-34473212 CTGTGGCAAGGCAGAGTGGAAGG + Intergenic
1125575178 15:40750461-40750483 CTGGGGGAGGCCAAGGTGGGCGG - Intronic
1125757766 15:42075880-42075902 CTGAGGAAAGGAAGGGAGGGAGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126677340 15:51171803-51171825 CTGGGGAACGGCAGGGAGATAGG - Intergenic
1126783094 15:52155163-52155185 CTGGAGAAAGGCCAGCTGGGAGG - Intronic
1127511529 15:59646397-59646419 TTGGGGAAAGGGTGGGAGGGTGG - Intronic
1127892732 15:63269595-63269617 GTGGGGAGGGGCAGGGCGGGGGG - Intergenic
1127899784 15:63332540-63332562 CTGGGGAAAGAATGGGTGGTGGG + Intronic
1128252372 15:66172271-66172293 CTGGAGGGAGGCAGGGTGAGAGG - Intronic
1128301139 15:66567095-66567117 ATGTGGAAGTGCAGGGTGGGAGG - Intergenic
1128452475 15:67813706-67813728 GAAGGGGAAGGCAGGGTGGGAGG + Intergenic
1128544503 15:68558067-68558089 CAGTGGAATGGCAGGGAGGGTGG + Intergenic
1128588889 15:68876758-68876780 CTTTGGGAAGCCAGGGTGGGTGG - Intronic
1128657746 15:69474904-69474926 CTCTGGAAATGCAGGCTGGGAGG - Intergenic
1128698235 15:69784946-69784968 CAGGGGAATGGCAGGGGGGTGGG + Intergenic
1128728095 15:70002567-70002589 CTGGGGGCAGGCAGGGCTGGTGG + Intergenic
1129184894 15:73899988-73900010 CTGGAGACAGGCAGAGGGGGCGG - Intergenic
1129394252 15:75235606-75235628 CAAAGGACAGGCAGGGTGGGAGG + Intergenic
1129657471 15:77533750-77533772 CTGGGGAAGGGAAGGGGAGGAGG - Intergenic
1129786785 15:78314958-78314980 CTTTGGAAAGTCAAGGTGGGAGG - Intergenic
1129888145 15:79052896-79052918 CTGGGGAAAGGAGGGGAGGGTGG - Intronic
1130050616 15:80480735-80480757 ATGGGGAGAGGAAGGGAGGGAGG - Intronic
1130173501 15:81543352-81543374 CTGGGGCAATGCAGGTTGGTTGG + Intergenic
1130200942 15:81826323-81826345 CTGGGGAAAGCCTTGGAGGGAGG - Intergenic
1130878139 15:88032080-88032102 CTGGGGACAGGAAGAGTAGGAGG + Intronic
1130894953 15:88162822-88162844 GGAGGGAAAGGCTGGGTGGGAGG - Intronic
1130991816 15:88880082-88880104 CTGGGCAAAGCCAGGTTGGGCGG + Intronic
1131034330 15:89211219-89211241 ATTGGGAAAGGAGGGGTGGGAGG - Intronic
1131246954 15:90802697-90802719 CTGTGAGAAGCCAGGGTGGGAGG + Intronic
1131605838 15:93901283-93901305 CTCAGCAAAGCCAGGGTGGGTGG - Intergenic
1131651946 15:94409854-94409876 AGGGGGAAAGGAAGGGTGAGTGG - Intronic
1131714592 15:95094778-95094800 GTGGGGAATGGGAGGTTGGGAGG - Intergenic
1131750952 15:95507546-95507568 TTGGGGATAGGCAGGGGGTGAGG - Intergenic
1131870504 15:96758623-96758645 TTGGGGAAAGAAAAGGTGGGGGG + Intergenic
1132075770 15:98818568-98818590 TTGGGGAGTGGCAGGGCGGGGGG + Intronic
1132077067 15:98830845-98830867 CTTTGGGAAGCCAGGGTGGGGGG - Intronic
1132189712 15:99842321-99842343 CTGTGGCAAGGCAGAGTGGGAGG - Intergenic
1132633913 16:933610-933632 ATGGAGAAAGGCAGGGGTGGGGG + Intronic
1132651297 16:1022518-1022540 CTGGGGAAAGACAGCGTGACTGG + Intergenic
1132670927 16:1102057-1102079 CTGGGGACAACCACGGTGGGTGG + Intergenic
1132704201 16:1235737-1235759 CTGTGGGAGGCCAGGGTGGGAGG - Intergenic
1132707317 16:1250688-1250710 CTGTGGGAGGCCAGGGTGGGAGG + Intergenic
1132801177 16:1754528-1754550 CTGTGGGAGGCCAGGGTGGGCGG + Intronic
1132839961 16:1974116-1974138 CTGGGGAAGGGCAGTGGGGCGGG + Intronic
1132863330 16:2082094-2082116 CTGGGCCCAGGCAGGGAGGGAGG - Intronic
1133453370 16:5921906-5921928 CTTTGGGAAGGCAAGGTGGGAGG + Intergenic
1133514645 16:6496714-6496736 CTGTGGGAGGCCAGGGTGGGTGG + Intronic
1133768542 16:8854595-8854617 GTGGGGAAAGGCGGGGGTGGCGG - Exonic
1133809282 16:9148765-9148787 TTGGGGAAAGTAATGGTGGGAGG + Intergenic
1133815837 16:9196765-9196787 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1133917925 16:10125813-10125835 GGGGGTAAAGGCTGGGTGGGAGG + Intronic
1134024925 16:10946250-10946272 CTGTGGAAAGGATTGGTGGGAGG + Intronic
1134234260 16:12453077-12453099 CTGGGAGAATGAAGGGTGGGAGG - Intronic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1134691259 16:16192238-16192260 GTGGGGAAAGGCAGGGAAGGAGG + Intronic
1134754021 16:16650613-16650635 CAGGAGAAAGGGAGGGAGGGAGG - Intergenic
1134807407 16:17137638-17137660 CTGGGGAAGGGCAGAGCAGGAGG - Intronic
1134992038 16:18708431-18708453 CAGGAGAAAGGGAGGGAGGGAGG + Intergenic
1135030331 16:19033002-19033024 CTGGGGAAGGTCATGGAGGGAGG + Intronic
1135147468 16:19975016-19975038 CTGGGGAAGTGCAGGGTTGAGGG - Intergenic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135957136 16:26965263-26965285 CTTTGGAAAGTCAAGGTGGGAGG + Intergenic
1136054374 16:27677466-27677488 CCGGGGGAAGGTGGGGTGGGGGG - Intronic
1136074819 16:27809788-27809810 CAGTGGAAAGACAGGGAGGGTGG - Intronic
1136077337 16:27826213-27826235 CTGGGGAAAGACACAGTGGCAGG + Intronic
1136114491 16:28086307-28086329 CTGGGTAGAGGCAGTGAGGGTGG - Intergenic
1136222438 16:28836866-28836888 CTGGGGAACGGGGGGATGGGGGG - Exonic
1136247182 16:28982834-28982856 CTGGGGGAAGAGAGGGTCGGGGG - Intronic
1136250972 16:29004857-29004879 CTGGGGAAGGGAAGGCAGGGTGG - Intergenic
1136347700 16:29686827-29686849 CTCTGGGAAGCCAGGGTGGGAGG - Intronic
1136381330 16:29897249-29897271 GTGGGGAAGGGAAAGGTGGGGGG - Intronic
1136461128 16:30410774-30410796 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1136543408 16:30941836-30941858 CTGTGGGCAGGCAGAGTGGGGGG + Intronic
1136543560 16:30942570-30942592 CTGGGCAAGGGTAGGGTAGGAGG + Intronic
1136612869 16:31377838-31377860 CTGGGGGAGGCCAAGGTGGGAGG + Intronic
1137442061 16:48506186-48506208 CTTTGGAAGGCCAGGGTGGGTGG + Intergenic
1137488222 16:48909309-48909331 CTGGTCAGAGGCAGGGTGGATGG + Intergenic
1137537754 16:49340336-49340358 ATGGGGAGAGGCAGGTTGGGGGG - Intergenic
1137646798 16:50082096-50082118 CTTGGGGAGGCCAGGGTGGGTGG + Intronic
1138134498 16:54509865-54509887 CTGGGGAGAGGCAGCGGGTGTGG - Intergenic
1138231723 16:55342448-55342470 CTGTGGAAAGCCAAGGTGGGAGG + Intergenic
1138318082 16:56087520-56087542 CAGGGGAGAGTCAGGCTGGGAGG + Intergenic
1138387693 16:56647603-56647625 GTGGGGAATGGAAGGGAGGGAGG + Intronic
1138539520 16:57679877-57679899 CTGGGGTAAGACAGGAAGGGAGG + Intronic
1138572600 16:57885145-57885167 ATGGGGTCAGGCAGAGTGGGAGG - Intronic
1138606566 16:58093863-58093885 TTGGGGAGGAGCAGGGTGGGTGG - Intergenic
1139301109 16:65946159-65946181 CTAGGGCAAGGCAGGGAGTGTGG - Intergenic
1139518080 16:67463758-67463780 GGGCTGAAAGGCAGGGTGGGTGG - Intronic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1139899934 16:70320349-70320371 CTGGGGGAGGCCAAGGTGGGAGG - Intronic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1141497501 16:84420122-84420144 CTGGGGAAAGGCCTGGGAGGAGG - Intronic
1141535304 16:84675273-84675295 CTTTGGAAGGCCAGGGTGGGAGG - Intergenic
1141707251 16:85673675-85673697 CTGGGGGCAGGCAGGGGGAGTGG - Exonic
1141786112 16:86201884-86201906 GTGAGGAGAGGCTGGGTGGGTGG + Intergenic
1142065637 16:88060859-88060881 ATGGTGAGAGGGAGGGTGGGCGG - Intronic
1142250012 16:88987037-88987059 CTGGGGAGAGGGAGGGACGGAGG - Intergenic
1142314255 16:89333519-89333541 CTGGGGAGAGGGAGGGACGGAGG - Intronic
1142323376 16:89399497-89399519 CTGGGGAGAGGGAGGGACGGAGG + Intronic
1142323765 16:89401092-89401114 CTGGGGAGGGGGAGGGCGGGTGG - Intronic
1142350406 16:89576863-89576885 CTGGGGACAGGCGGTGAGGGCGG - Intronic
1142352302 16:89585956-89585978 CTGGGGAGGAGCAGGTTGGGGGG + Intronic
1142467498 17:144695-144717 ATGGGGACAGTCAGGCTGGGAGG - Intergenic
1142572177 17:882247-882269 GCAGGGAAAGGCAGGGAGGGAGG - Intronic
1142656632 17:1399267-1399289 CTGAGGAAAGGGAGGGAGTGAGG + Intronic
1142685349 17:1574529-1574551 CTGGGGGCAGTCAAGGTGGGCGG + Exonic
1142731005 17:1857651-1857673 CTGGGGACGGGCCGGGTGGGGGG - Intronic
1142886476 17:2915476-2915498 CTTTGGAAAGCCAAGGTGGGCGG - Intronic
1142977923 17:3656339-3656361 GAGGGGCAGGGCAGGGTGGGGGG - Intronic
1142993804 17:3749216-3749238 TTGGGGGAATGAAGGGTGGGGGG + Intronic
1143190391 17:5035801-5035823 GTGGGGAGAGGCTGAGTGGGAGG - Intronic
1143320174 17:6063248-6063270 CTAAGGAAAGGCAGGGAGGAGGG - Intronic
1143473821 17:7192003-7192025 CTGGGGGCAGGCAGGGTGGGCGG + Intronic
1143612303 17:8025731-8025753 CTGGGGCAAGACAGGGTGGCAGG + Intergenic
1143722583 17:8823087-8823109 CTGGAGAGAGGAAGGGAGGGTGG + Intronic
1143863070 17:9905204-9905226 CTGGGGAGTCGCTGGGTGGGTGG + Exonic
1143899808 17:10165735-10165757 CTTGGGAGCTGCAGGGTGGGAGG - Intronic
1144066261 17:11627074-11627096 CTGGGGGAAAGCTGGATGGGTGG + Intronic
1144201746 17:12948332-12948354 CAGGGGAAGGGCAGACTGGGTGG - Intronic
1144271633 17:13623331-13623353 CTTTGGGAAGCCAGGGTGGGAGG - Intergenic
1144497087 17:15754819-15754841 CTGGGAAGTGGCATGGTGGGGGG - Intergenic
1145000165 17:19299365-19299387 CAGGCGTAAGCCAGGGTGGGAGG - Intronic
1145208278 17:20995993-20996015 GTGGGGACAGGAAGTGTGGGAGG - Intergenic
1145262681 17:21364221-21364243 CTGGGGAAAGGATGAGAGGGTGG + Intergenic
1145367650 17:22278291-22278313 TTGTGGAAGGGCAGGGTGGGGGG + Intergenic
1146156683 17:30530285-30530307 CTGTGGAAAGGAAGAGTGCGTGG - Intergenic
1146160031 17:30554785-30554807 CTCGGGGGAGGTAGGGTGGGAGG + Intergenic
1146627623 17:34446196-34446218 GTGGGGAAAGGCAGGGAGATGGG + Intergenic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146682357 17:34817249-34817271 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1146739579 17:35270771-35270793 CTGGGGTAGGGGAGGGAGGGTGG - Exonic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1146890255 17:36502095-36502117 CCAGGGTAAGGCTGGGTGGGAGG + Intronic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1147254506 17:39174091-39174113 CTGGGGAGGGGCAGGGTTGCTGG + Exonic
1147324943 17:39665648-39665670 CTGGGCACAGGCTGGGTGGGGGG - Intronic
1147371820 17:39997720-39997742 CTGGGGGAGGTCAGGGTGGCTGG - Exonic
1147758576 17:42783500-42783522 CAGTGACAAGGCAGGGTGGGAGG - Intronic
1147799440 17:43072849-43072871 CTGGGGCCAGGCGTGGTGGGTGG - Intronic
1147812820 17:43185328-43185350 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1147943915 17:44069562-44069584 CTTTGGAAGGCCAGGGTGGGTGG - Intergenic
1148029304 17:44608703-44608725 CGGGGGAAGGGCAGGTAGGGAGG - Intergenic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148157726 17:45433018-45433040 CCCGGGAAAGGCAGGGGAGGGGG - Intronic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148386299 17:47237524-47237546 CAAGGGAGTGGCAGGGTGGGGGG - Intergenic
1148443234 17:47722483-47722505 CTGGAGAAAGGCAAGATGGAAGG - Intergenic
1148469224 17:47883253-47883275 GTGGGGAGAGGTAAGGTGGGCGG - Intergenic
1148564393 17:48624899-48624921 CCGGGGAGAGGAGGGGTGGGGGG - Intronic
1148773588 17:50080599-50080621 CTGGGGAAAGGCATGGAGGTGGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1148860561 17:50602322-50602344 CTGGGGCAGGGCAGGGAGGAAGG - Intronic
1149399760 17:56283734-56283756 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1149568015 17:57653095-57653117 GTGGGGCTGGGCAGGGTGGGGGG + Intronic
1149576018 17:57714117-57714139 CTTTGGGAAGGCAAGGTGGGTGG + Intergenic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1149904762 17:60515357-60515379 CTTTGGAAGGCCAGGGTGGGTGG - Intronic
1149997704 17:61413325-61413347 CTGGGGAATGCCAGAGTTGGAGG + Intergenic
1150147683 17:62782877-62782899 CAGAGGAAGGGCAGGGTGAGAGG - Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150473840 17:65459610-65459632 CTGGGGGTCGGCGGGGTGGGGGG + Intergenic
1150514946 17:65798345-65798367 CTGGGGAAAGGCTAGCTGGCTGG + Intronic
1150633851 17:66898929-66898951 CTTGGGAAAGGAAGGGTGGGAGG - Intergenic
1151313661 17:73309542-73309564 ATGGGGACAAGCACGGTGGGTGG + Intronic
1151768099 17:76142335-76142357 CTAGGGAAAGGCATGTTGGCGGG - Intergenic
1151802127 17:76384813-76384835 CGGCGCGAAGGCAGGGTGGGCGG - Exonic
1151898091 17:76993957-76993979 CTGGGGGAGGGTGGGGTGGGAGG - Intergenic
1152050730 17:77974032-77974054 CTGGAGAGAGGGAGGGAGGGAGG + Intergenic
1152239680 17:79154895-79154917 CTGTGGAAGAGCAGGGAGGGAGG - Intronic
1152462830 17:80450294-80450316 AGGGTGCAAGGCAGGGTGGGAGG + Intergenic
1152496652 17:80677569-80677591 CTGGTGAGAGGGAAGGTGGGAGG - Intronic
1152800335 17:82327948-82327970 CGGTGGACGGGCAGGGTGGGGGG - Intronic
1152853017 17:82648643-82648665 GCGGGGAGAGGCAGGGCGGGCGG + Intergenic
1152853031 17:82648677-82648699 GCGGGGAGAGGCAGGGCGGGCGG + Intergenic
1152853074 17:82648780-82648802 GCGGGGAGAGGCAGGGCGGGCGG + Intergenic
1153283892 18:3439775-3439797 CTTGGGGAAGCCAAGGTGGGCGG + Intronic
1153489027 18:5629598-5629620 CTGGGGAAACGCGGGGGAGGGGG - Intronic
1153797419 18:8637018-8637040 CTTTGGAAAGTCAAGGTGGGAGG + Intronic
1153802011 18:8679692-8679714 CTTTGGGAAGTCAGGGTGGGAGG - Intergenic
1153890633 18:9511082-9511104 CTCTGGAAGGCCAGGGTGGGTGG - Intronic
1154009059 18:10560074-10560096 CTGGGGAGGGGCAGGGTGAGGGG - Intergenic
1154024546 18:10695299-10695321 CTGGGGAGAAGAAGGCTGGGAGG + Intronic
1154131094 18:11737896-11737918 AGGGGGAATGGCAGGGTGAGGGG - Intronic
1154219275 18:12437846-12437868 ATGGGAAAAGCCAGGTTGGGAGG + Intergenic
1154496858 18:14967580-14967602 CCAGGGAAAGGCATGGTGTGGGG + Intergenic
1154939023 18:21092336-21092358 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1155012675 18:21796380-21796402 CTGGGGCCTGTCAGGGTGGGGGG + Intronic
1155021654 18:21902243-21902265 CAGAGGAAAGGAAGGCTGGGAGG - Intergenic
1155046225 18:22105707-22105729 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1155251863 18:23960528-23960550 CTCTGGAAAGTCAGGGTAGGAGG + Intergenic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1155381192 18:25224514-25224536 GAGGGGAAAGGCAAGGTGGGGGG - Exonic
1155809365 18:30212116-30212138 GTGGGAAAAGGCAGGGTGGGGGG + Intergenic
1156123155 18:33869932-33869954 ATGAAGAAAGGCAGGGTGGATGG + Intronic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1157413511 18:47483369-47483391 TCGGGGAAAGCCACGGTGGGTGG - Intergenic
1157559081 18:48633456-48633478 CTGTGGGAAGCCAAGGTGGGTGG + Intronic
1157603069 18:48906517-48906539 CTGTGGGAGGCCAGGGTGGGTGG + Intergenic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157738657 18:50072967-50072989 TTGTGGAAAGGTATGGTGGGAGG + Intronic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1157842141 18:50968296-50968318 CTCGAAAAAGGCTGGGTGGGCGG - Intronic
1158452513 18:57579964-57579986 CTGGGAAAAGCCAGTGTGGAAGG - Intronic
1158535655 18:58306047-58306069 CTTTGGAAAGGCAGGGATGGAGG + Intronic
1159069436 18:63606751-63606773 CTGAGGAAAGACAGAGTGGCTGG + Intergenic
1159576015 18:70178398-70178420 CTGGGGATAGGCAGAATGAGGGG + Intronic
1160123631 18:76151451-76151473 ATGGGGAAAGGGAAGGTGTGAGG - Intergenic
1160195099 18:76747204-76747226 TTGGGGAAAGGCTGGGAAGGTGG + Intergenic
1160391216 18:78534773-78534795 CCTGGGAAGGGCAGGGTGGGTGG + Intergenic
1160409149 18:78663144-78663166 CTGGGGGAGGGCCGGGTGGGAGG + Intergenic
1160515650 18:79478074-79478096 CTGGGGATGGGCAGGCAGGGGGG - Intronic
1160594107 18:79962480-79962502 CTCGGGAAAGCCAGTGTGGGTGG - Intergenic
1160802092 19:974853-974875 GTAGGGACAGGCGGGGTGGGTGG + Exonic
1160833480 19:1113812-1113834 CTGAGGGACGGCAGGGTGGCGGG + Intronic
1160913762 19:1487342-1487364 GTGGGGAAGGGCAGGGCCGGTGG - Intronic
1160979852 19:1811962-1811984 CTGCGGGAAGACGGGGTGGGGGG - Intronic
1161214149 19:3084973-3084995 CTGAGGACAGGCAGGGTGCAAGG - Intergenic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161326785 19:3667974-3667996 CTGGAGAGGGGCAGGGAGGGCGG - Intronic
1161459226 19:4386677-4386699 CTGGGGAAAGGCATGGAAGCTGG - Intronic
1161736475 19:5995112-5995134 CTGGGTAACGGCAGGTGGGGAGG - Intronic
1161763333 19:6190474-6190496 CTGGGGCTAGGCTGGGTGGCTGG - Intronic
1161919778 19:7257435-7257457 AAGGGGAAAGGCGGGGTGGGAGG + Intronic
1161958519 19:7509478-7509500 ATGGGGAAGGCCAGGGTGTGGGG + Intronic
1162110784 19:8398526-8398548 CTGGGGACAGGGGTGGTGGGAGG + Intronic
1162251665 19:9449723-9449745 CTTTGGAAAGTCAAGGTGGGTGG + Intergenic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162429489 19:10619077-10619099 CTGGGGAAGCCTAGGGTGGGAGG - Intronic
1162569844 19:11465591-11465613 CTGGAGGAAGCCAGGGTCGGGGG - Intronic
1162725642 19:12688523-12688545 CCGGGGGCAGGCAGGGAGGGAGG - Intronic
1162738986 19:12763230-12763252 CTGGAGGAAGCCAGGGTGGGTGG + Exonic
1162767249 19:12927309-12927331 ATGGGGGCAGGCAGGGTGTGGGG + Intronic
1162905452 19:13820477-13820499 CTTTGGAAAGCCAAGGTGGGCGG - Intronic
1162971655 19:14184275-14184297 CTGGAGACAGGCAGGCGGGGTGG + Intronic
1163112422 19:15169823-15169845 CTGGGGAGGGGCAGGATGGAGGG + Intronic
1163268347 19:16234539-16234561 CTGGGCAGAGGCTGGGAGGGTGG - Exonic
1163271986 19:16259976-16259998 CTGGGGAGAGGCAAGGGGGCAGG + Intergenic
1163338844 19:16691106-16691128 TTGGGGAAAGGCAGGTAGGGTGG + Intergenic
1163387291 19:17007675-17007697 CAGGGGATAGGTAGGGTGTGGGG - Intronic
1163621644 19:18364368-18364390 CTTTGGAAGGCCAGGGTGGGCGG + Exonic
1163760541 19:19133996-19134018 CTGGGGGAAGCCAAGGTGGGAGG - Intronic
1164524539 19:29003746-29003768 CTCGGGGAAGACAGGCTGGGAGG + Intergenic
1164607868 19:29613013-29613035 CAGGAGGAAGGCAGTGTGGGAGG - Intronic
1164674609 19:30093026-30093048 CTTGGGAGAGTCAGGCTGGGAGG - Intergenic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1164794455 19:31014807-31014829 ATGGGAAAAGGGAGGGAGGGAGG + Intergenic
1165052591 19:33151440-33151462 CTGGGGACAGGCAGGCAGGAGGG + Intronic
1165177392 19:33940247-33940269 AAGGGGAAAGGCAGGGAGGCTGG - Intergenic
1165300173 19:34963742-34963764 CTGGGGCACGGCCAGGTGGGTGG - Exonic
1165312619 19:35038046-35038068 CTGGGGCAGGGCAGGCAGGGGGG + Intronic
1165616375 19:37205144-37205166 CACTGGAAAGCCAGGGTGGGAGG - Intronic
1165716049 19:38046501-38046523 CTGGAAAGAGGCAGGGTGGCCGG + Intronic
1165787579 19:38471283-38471305 CTGTGGGAAGCCAAGGTGGGAGG + Intronic
1165832452 19:38736391-38736413 CAGGGGTTAGGCAGGGTGGACGG - Intronic
1165859139 19:38898213-38898235 CTGGGGAAAGGCAGATTCTGGGG - Intronic
1165876040 19:39007578-39007600 CTGGGGAGATGCAGAGTTGGGGG - Intronic
1166038056 19:40183711-40183733 CTTTGGAAAGCCAAGGTGGGCGG + Intergenic
1166218530 19:41351737-41351759 CAGGGGAAGTGCTGGGTGGGGGG - Intronic
1166253498 19:41586652-41586674 CTGGGGACAGGAAGGGATGGGGG + Intronic
1166293738 19:41878967-41878989 CTGTGGAGAGACAGGGTGGGTGG - Intronic
1166617570 19:44264323-44264345 CTGGGGAAGGGCAGGGTCCTGGG - Exonic
1166680585 19:44764009-44764031 TTTGGGGAAGGCAAGGTGGGAGG + Intergenic
1166827868 19:45620776-45620798 CAGGGGTAAGGAAGGGAGGGAGG + Intronic
1167121690 19:47521113-47521135 CAGGGGACAGGGAGGGTGGGGGG + Exonic
1167173387 19:47848815-47848837 CTGGGGGAAGGGAGGGTGTTTGG - Intergenic
1167209318 19:48123103-48123125 CTGGGGACAGGCTGGGAGGCCGG + Intronic
1167254377 19:48418531-48418553 CTGGGGAAATGGTTGGTGGGAGG + Intronic
1167342742 19:48925469-48925491 CCAGGGATGGGCAGGGTGGGGGG + Intergenic
1167381816 19:49142703-49142725 GTGGGGAAAGGCAAGGGGGTGGG - Intronic
1167575293 19:50314896-50314918 CCGGGGAGAGCCAGGGGGGGTGG + Intronic
1167622045 19:50566114-50566136 CTGCGGAAAGGCAGGTTAGAAGG + Intronic
1167625425 19:50585303-50585325 CTTGGGAAGGCCAGGGTGGGAGG + Intergenic
1167749579 19:51371665-51371687 CTGGGGAAGGGCTGGAAGGGCGG + Exonic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167827296 19:51985761-51985783 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1167967505 19:53159106-53159128 CTGGGGAGAGGCGGGGTCTGCGG + Intergenic
1167998467 19:53425854-53425876 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
1168405541 19:56108411-56108433 CTGGGCAGGGGCAGGGTGGAGGG - Intronic
1168532862 19:57143631-57143653 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
925219719 2:2128546-2128568 CTGGTGAAAGGTAGAGTTGGTGG + Intronic
925574211 2:5343824-5343846 CTGAGGAACGGCCAGGTGGGTGG - Intergenic
925863197 2:8200250-8200272 CAGGGGAGAGACCGGGTGGGAGG - Intergenic
925901579 2:8512974-8512996 CAGGGCAAGGGCAGGGAGGGTGG - Intergenic
926135416 2:10332479-10332501 GGTGGGCAAGGCAGGGTGGGAGG + Intronic
926411116 2:12604029-12604051 CTGGGGGAGGGCAGGAAGGGTGG - Intergenic
927159279 2:20242530-20242552 GTGGGGAAAGGGCGGGGGGGGGG + Intergenic
927312599 2:21647964-21647986 CTGGGGAGACCCAGGGCGGGGGG + Intergenic
927339108 2:21961188-21961210 ATGGGGAAAGGTTGGGAGGGGGG - Intergenic
927466719 2:23342210-23342232 ATGGGAAAGGGCAGGGTCGGGGG - Intergenic
927861150 2:26561057-26561079 CAGGTGGAAGGCAGGGTGGTGGG + Intergenic
927944125 2:27124301-27124323 TTGGGGAAAGGTGGGGTGGAAGG + Intronic
928178787 2:29053190-29053212 CTGGGGAAGGGCAGGGGAGGGGG - Exonic
928414893 2:31083917-31083939 CTGGTGAAAGGCTGTGTGGTTGG + Intronic
928439936 2:31284022-31284044 CTGGGAAGTGGCTGGGTGGGAGG - Intergenic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
928836377 2:35551724-35551746 CAGGGGAAGGGCATGGTGGGAGG - Intergenic
929034241 2:37675225-37675247 TTAGGGAAAGGGAGTGTGGGAGG - Intronic
929055823 2:37875299-37875321 CTAGGGAACTGCAGGGCGGGAGG + Intergenic
929188543 2:39120261-39120283 CTGGGGAAGGGCTGGGGAGGCGG - Intronic
929191759 2:39146786-39146808 CTTTGGGAAGCCAGGGTGGGAGG + Intergenic
929285219 2:40128043-40128065 CTGAGAAAAGGCAGGATGTGAGG + Intronic
929489633 2:42384853-42384875 CTGGGGGAAGGCAGGTGGGCAGG - Intronic
929546930 2:42861919-42861941 ATGAGGCTAGGCAGGGTGGGGGG - Intergenic
930095405 2:47562594-47562616 CTAGGGAATGGCAGGGTTTGGGG + Intronic
930794590 2:55375138-55375160 CTTTGGAAAGCCAGGGTGGGAGG + Intronic
931198288 2:60073634-60073656 GTTTCGAAAGGCAGGGTGGGTGG + Intergenic
931224917 2:60321367-60321389 CTGGGGAAGTGCTGGGTGGAAGG - Intergenic
931421974 2:62136429-62136451 CTTTGGGAAGCCAGGGTGGGAGG - Intronic
931511428 2:63000090-63000112 CTGGGGGGAGGCAGGATGGGTGG + Intronic
931530469 2:63208935-63208957 CTGGGGGGAAGCAGTGTGGGAGG - Intronic
931881556 2:66575801-66575823 CGGGGGCAAGGCCGGGAGGGCGG + Intergenic
933726484 2:85430316-85430338 CTGGGGAAAGGTGGGCAGGGAGG + Intronic
933758869 2:85661178-85661200 CTGGGACAGGGCAGGGCGGGGGG + Intronic
933775791 2:85770434-85770456 CTGGGGAAAAGGGGGGTGGGTGG + Intronic
933831185 2:86210307-86210329 CCGGGGGAAGGGAGGGTGGCGGG - Intronic
933846889 2:86334022-86334044 CTGGGGACAAGCAGAGTGGCTGG - Intronic
934060004 2:88284423-88284445 CTGCGGATTGGCAGGTTGGGCGG - Intergenic
934656655 2:96119921-96119943 CTGGAGAAAGGTGGGGTGTGTGG - Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934766491 2:96882894-96882916 ATGGGGAAAGGCAGAGTCTGAGG + Intronic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
934912350 2:98270911-98270933 CTTGGGATAGGCAGAGAGGGAGG - Intronic
935110807 2:100092600-100092622 GTTGGGAATGGCAGGATGGGAGG - Intronic
935708387 2:105876313-105876335 CTCGGTAAGGGCAGGATGGGAGG + Intronic
936064081 2:109317454-109317476 CAGGGGAAGAGCAGGGTGGGGGG - Intronic
936124166 2:109772562-109772584 GTTGGGAATGGCAGGATGGGAGG + Intergenic
936220523 2:110598902-110598924 GTTGGGAATGGCAGGATGGGAGG - Intergenic
936341082 2:111633274-111633296 GTGGGGAAAGTCAGGCTTGGAGG - Intergenic
936550390 2:113433453-113433475 CTTTGGAAAGCCAGGGCGGGTGG - Intergenic
936600428 2:113889971-113889993 CCGGGGAAAGGCGGCGTGAGGGG + Exonic
936978403 2:118241656-118241678 CTGGGGCCATGGAGGGTGGGTGG + Intergenic
937088225 2:119186207-119186229 CCAGGGAAAGGCTGGTTGGGAGG - Intergenic
937222212 2:120348151-120348173 CTTGGGAGGGGCATGGTGGGAGG + Intronic
937236987 2:120437033-120437055 CTGGGGGAAGGCAGCAGGGGAGG + Intergenic
937263618 2:120601997-120602019 CTGGGCAGGGGCATGGTGGGTGG - Intergenic
937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG + Intergenic
937985587 2:127636771-127636793 CTGGGGGCAGAGAGGGTGGGTGG - Intronic
938091906 2:128440012-128440034 ATGGGGAAAGCCGTGGTGGGGGG - Intergenic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
938279960 2:130056890-130056912 GTGGGGAAAGGCAGAGATGGGGG - Intergenic
938429561 2:131220445-131220467 CTTGGGGAAGCCAAGGTGGGTGG - Intronic
938435427 2:131280547-131280569 GTGGGGAAAGGCAGAGGTGGGGG + Intronic
938954192 2:136283111-136283133 CTGAGGAAAGGCACCTTGGGTGG - Intergenic
938968952 2:136414884-136414906 CAAGAGACAGGCAGGGTGGGAGG + Intergenic
939384084 2:141474077-141474099 CGGAGGAAAGGAAGGGAGGGAGG - Intronic
939767372 2:146267517-146267539 CTGGGAAAAGTCAGGGTGTATGG - Intergenic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
941892107 2:170593344-170593366 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
942139435 2:172963189-172963211 CAGGGGAAGGGCCTGGTGGGAGG - Intronic
942404676 2:175641760-175641782 CTTTGGGAAGGCAAGGTGGGTGG - Intergenic
943598041 2:189880468-189880490 ATGGTGAAAGGCAGGCTGGAAGG + Intronic
944809318 2:203312318-203312340 CTGGGGAGAGGAAGGCTGGGTGG + Intergenic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945225515 2:207529159-207529181 CTGGAGAAAGGCGGGGAGGTAGG + Intergenic
945284197 2:208065822-208065844 CTGTGGAAAGGCGGGTGGGGAGG + Intergenic
945439085 2:209857031-209857053 CTTTGGGAAGGCAAGGTGGGTGG - Intronic
945444039 2:209914583-209914605 CTGGGGAAAGGAATGGTGCTGGG - Intronic
945563534 2:211368039-211368061 CGGGGGAAGGGCCTGGTGGGAGG - Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946312278 2:218889071-218889093 TTGGGGAAAGGTTGGGTGTGAGG - Intronic
946371687 2:219285184-219285206 CTGGTGAAGCCCAGGGTGGGGGG + Exonic
946409592 2:219509504-219509526 CTGGGGAAGGGGAGCGGGGGTGG - Intergenic
946432439 2:219632796-219632818 GGGGGGCAAGGCAGAGTGGGAGG + Intronic
946441979 2:219704387-219704409 CTGGGGGAGGGCAGTGTGGAGGG - Intergenic
947030110 2:225783210-225783232 AGGGGGAAAGGGAGGGAGGGAGG - Intergenic
947438463 2:230094501-230094523 CAGGGGAAAGGGTGGGAGGGAGG - Intergenic
947470184 2:230394562-230394584 CTGGGGAAAGGTAGAGTTGCTGG - Intronic
947523860 2:230866732-230866754 CTGGGGAGGGGCAGGGATGGGGG + Intronic
947581396 2:231321364-231321386 GTGGGGAAAGGAGGGGTGGGAGG + Intronic
947956335 2:234195333-234195355 CTGGGGGAAGGCAGGGTCTGGGG - Intergenic
948178489 2:235961992-235962014 CTGGGGCAGGGCGGGGTGGAGGG + Intronic
948277480 2:236720119-236720141 AGGGGGAAAGGAAGGGAGGGAGG + Intergenic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948588208 2:239034506-239034528 CTGGGGAAACCCAGAGTGGGGGG - Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948754086 2:240149219-240149241 CTTGGGAGAGGCAGGAAGGGTGG - Intergenic
948861038 2:240752696-240752718 CTGGGAAAATGTGGGGTGGGTGG - Intronic
949066802 2:241995943-241995965 CTGTGGGAGGCCAGGGTGGGTGG - Intergenic
1168831930 20:850379-850401 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1168856083 20:1010019-1010041 CTGGGCAAAGGCAGGCTGCTGGG + Intergenic
1168968834 20:1916934-1916956 CTGGACATAGGCAGGGAGGGTGG + Intronic
1168979895 20:1995517-1995539 CTGGGGAGAGGCAAGGGAGGGGG - Intergenic
1168997781 20:2145762-2145784 CCAAGGAAAGGCAGGGTGGCGGG - Exonic
1169123241 20:3109856-3109878 CTGGGCTCAGGCAGGGGGGGTGG + Exonic
1169210612 20:3764435-3764457 CTGGGCAAAGGCAGGGCGGGGGG - Intronic
1169287102 20:4318505-4318527 CTGGGGACAGGAAGGGAGTGGGG + Intergenic
1169305223 20:4483703-4483725 CTCAGGAAAGGGAGGGAGGGAGG - Intergenic
1169402533 20:5295243-5295265 GTGGGGACAGGCAGGATGGAAGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1170435795 20:16327285-16327307 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1170645343 20:18192413-18192435 CTTGGGAAGGCCAAGGTGGGTGG - Intergenic
1170951682 20:20942058-20942080 CTGTGAAAAGGCAGGGGAGGGGG + Intergenic
1171035469 20:21709517-21709539 CTGGGAAAAGGGAGAGCGGGTGG + Intronic
1171159921 20:22912366-22912388 TTGGGGGAAGGGTGGGTGGGGGG - Intergenic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171332220 20:24350520-24350542 CAAAGGGAAGGCAGGGTGGGGGG - Intergenic
1171456204 20:25273954-25273976 CTCTGGGAAGCCAGGGTGGGAGG - Intronic
1171782028 20:29427954-29427976 CAGGGGCAGGGCAGGGGGGGAGG - Intergenic
1171974922 20:31588150-31588172 CTGGGGAGAAGCAGGAGGGGCGG - Intergenic
1172053416 20:32137251-32137273 CCGGGGAGAGGCAAGGTGGCTGG - Intronic
1172371165 20:34393263-34393285 CTTTGGGAAGTCAGGGTGGGAGG + Intronic
1172689235 20:36779006-36779028 CTGGTGAAGGGCAGGAAGGGAGG + Exonic
1172692196 20:36797574-36797596 CTGGGCAAGGGCAGAGAGGGTGG + Intronic
1172770332 20:37378835-37378857 CTGGAGATAGACAGGGTGGAGGG + Intronic
1172881720 20:38204433-38204455 CTGGGGATAGGGGAGGTGGGAGG - Intergenic
1172933314 20:38601267-38601289 CTGGGGAAAGGCTGGGTAAGGGG - Intergenic
1173118033 20:40264665-40264687 AGGGGGAAGGGCAGGGTGTGGGG - Intergenic
1173620477 20:44432017-44432039 CTGCGGTAAGGCAGGGAGGCTGG + Exonic
1173656950 20:44705986-44706008 CTGAAGAGAGGCAGGGAGGGAGG - Intergenic
1173727807 20:45309131-45309153 CCTGGGGAAGGCAGGGTGGGGGG - Intronic
1173843985 20:46176707-46176729 CTGGGGACAGGCCCGGAGGGAGG + Intronic
1173860861 20:46282749-46282771 CCGGGGGAGGGAAGGGTGGGTGG + Intronic
1174079879 20:47963056-47963078 GTGGGGAAAAGAAGGGAGGGAGG - Intergenic
1174295514 20:49542524-49542546 CTGGGGAGAGGCAGGCTCAGGGG - Intronic
1174411020 20:50335739-50335761 CTTTGGAAGGCCAGGGTGGGTGG - Intergenic
1174463512 20:50699636-50699658 CAGGTGAAAGGCAAGGTGGGTGG - Intergenic
1174654993 20:52164065-52164087 CTTTGGGAAGGCAAGGTGGGTGG + Intronic
1174658563 20:52191731-52191753 TTGGGAGAAGGCAGGGTGGGGGG - Exonic
1174700994 20:52609297-52609319 ATGGGTGAAGTCAGGGTGGGAGG - Intergenic
1175182844 20:57160727-57160749 CTGGGGAAAGGCAGTGAAGCTGG - Intergenic
1175248837 20:57597046-57597068 GTGGGGTCAGGCGGGGTGGGGGG - Intergenic
1175261630 20:57678196-57678218 CTGGGGAAAGGTAAGGTTGATGG + Intronic
1175325119 20:58120221-58120243 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1175544029 20:59766509-59766531 CTGGGGATGGGCAGGCTGAGGGG + Intronic
1175706847 20:61185449-61185471 CCGGGGCAAAGCAGGGTGTGTGG - Intergenic
1175722491 20:61295717-61295739 CTGGGGAAAAGCGGGGAAGGAGG + Intronic
1175803297 20:61813357-61813379 CTGGGGAGGGGCAGGTTGAGGGG - Intronic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1175942409 20:62543581-62543603 TGGGAGAGAGGCAGGGTGGGGGG - Intergenic
1175946225 20:62560113-62560135 CTGGGGGGAGGCAGGGCGGGAGG - Intronic
1176022759 20:62970537-62970559 CTGAGGAAAGGCCGGGGAGGTGG - Intergenic
1176109648 20:63405535-63405557 CTCCGGAAAGGCGGGGAGGGCGG + Intergenic
1176286365 21:5021299-5021321 GCGGGGAAGGGCAGGGAGGGCGG - Intergenic
1177519966 21:22208514-22208536 CGGGGGAAAGGGTGGGAGGGAGG - Intergenic
1177528622 21:22331732-22331754 CAGGGGAAAGGGTGGGTGTGGGG + Intergenic
1178467665 21:32863052-32863074 CTGGTGAAAGGAAGGAAGGGAGG - Intergenic
1179210891 21:39323415-39323437 CTCTGGGAAGCCAGGGTGGGAGG + Intergenic
1179238241 21:39566224-39566246 CTGGAGAGAGGCATGGTGGCTGG + Intronic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1179437197 21:41369929-41369951 CTGGCTAAAGGCAGGCTGAGGGG - Intronic
1179474078 21:41632180-41632202 CTGGGAAGAGGCAGGGGGTGGGG + Intergenic
1179635304 21:42704795-42704817 CTTGGGAAAGGCTGGGTGTGGGG - Intronic
1179728104 21:43351721-43351743 CTTGGGAAAGGCAGGGCAGGCGG - Intergenic
1179807599 21:43849837-43849859 CTGGGAAATGGCAGGGCCGGGGG + Intergenic
1179870816 21:44242176-44242198 GCGGGGAAGGGCAGGGAGGGCGG + Intergenic
1179883230 21:44302042-44302064 CTGTGGACAGGCCGGCTGGGTGG + Intronic
1179902985 21:44403288-44403310 CTGGGGCTAGGGAGGGTGTGGGG + Intronic
1179909780 21:44441639-44441661 CTGGGCAGAGGCAGGGCTGGCGG + Intronic
1179914358 21:44466889-44466911 CTGGGGAAGGTCAGCCTGGGTGG - Intergenic
1179978012 21:44881651-44881673 CTGGGGTGAGGCATGGAGGGAGG + Intergenic
1179996027 21:44974840-44974862 CTGGGGAGAGGCGGAGAGGGAGG - Intronic
1180098550 21:45573414-45573436 CTGGGGTAGGGCAGGGGGTGGGG + Intergenic
1180762367 22:18220051-18220073 CTGGGGAAAGGAGGGCTGGGGGG + Intergenic
1180773301 22:18404557-18404579 CTGGGGAAAGGAGGGCTGGGGGG - Intergenic
1180782430 22:18528718-18528740 GTGGGGTGAGGCAGGGCGGGCGG + Intronic
1180804654 22:18654106-18654128 CTGGGGAAAGGAGGGCTGGGGGG - Intergenic
1180806094 22:18715304-18715326 CTGGGGAAAGGAGGGCTGGGGGG + Intergenic
1180875044 22:19171283-19171305 CAGGGGAAAGGAGGGGCGGGAGG + Intergenic
1180937746 22:19637229-19637251 TTGGGGAAGCCCAGGGTGGGAGG + Intergenic
1181084607 22:20433762-20433784 CTGGGTCAGGGCTGGGTGGGTGG - Intronic
1181099855 22:20531880-20531902 CTGGGTGGAAGCAGGGTGGGAGG + Intronic
1181180557 22:21065193-21065215 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1181192397 22:21151490-21151512 CTGGGGAAAGGAGGGCTGGGGGG - Intergenic
1181217042 22:21341085-21341107 CTGGGGAAAGGAGGGCTGGGGGG + Intergenic
1181259277 22:21585741-21585763 CTGGGGAAAGACATAGAGGGGGG + Intronic
1181477239 22:23176243-23176265 TTGGGGAAAAGCTGGGTGTGGGG + Intergenic
1181539141 22:23564088-23564110 GTGAGGAGAGGCAGGGCGGGAGG - Intergenic
1181552539 22:23649027-23649049 CTTTGGAAAGGCAAGGTGCGAGG - Intergenic
1181582155 22:23834375-23834397 CTGGGGAGGGGTAGGGAGGGTGG - Exonic
1181588383 22:23867085-23867107 TGGGGCAAAAGCAGGGTGGGAGG + Intronic
1181642486 22:24210626-24210648 CTTTGGAAGGCCAGGGTGGGCGG + Intergenic
1181692776 22:24574420-24574442 TGGGGTAAAGGCAGGGTAGGAGG - Intronic
1181728411 22:24827383-24827405 GTGGGGAGAGGGAGGGAGGGCGG + Intronic
1182013900 22:27023026-27023048 CTGGGGCTAGGGAGGGAGGGAGG + Intergenic
1182107437 22:27699459-27699481 CTAGGGAAAGGCAGGTAGAGAGG - Intergenic
1182223368 22:28776163-28776185 CTTGGGGAGGCCAGGGTGGGTGG + Intronic
1182306864 22:29375834-29375856 CTGGTGGAAAGAAGGGTGGGAGG + Intronic
1182326913 22:29520172-29520194 GTGGGGCATGGGAGGGTGGGAGG - Intronic
1182455251 22:30446334-30446356 CTGAGCAAAGGCAGGGAGGCAGG - Intergenic
1182499409 22:30734945-30734967 CTTTGGAAAGCCAAGGTGGGAGG + Intronic
1182508648 22:30803173-30803195 CTGGGGTGAGTCAGGGCGGGCGG + Intronic
1182520067 22:30880202-30880224 CTGGTGAGAGGCAGGGTCTGTGG + Intronic
1182579831 22:31300180-31300202 CTGAGGAAAAGCAGGTTTGGGGG + Intergenic
1182731317 22:32497302-32497324 AGGGGGAAAGGCTGGGAGGGAGG - Intronic
1183279504 22:36924400-36924422 CTGGGAGAGGGCATGGTGGGTGG - Intronic
1183366428 22:37409450-37409472 TTGGGGAAAGGTAGGGTGTGGGG - Intronic
1183474204 22:38026900-38026922 CTGGGGCAAGGCAGGGCCAGAGG - Intronic
1183630602 22:39030264-39030286 GTGGGACACGGCAGGGTGGGTGG - Intronic
1183676931 22:39304370-39304392 CTGGGGAGGGCCATGGTGGGAGG + Intergenic
1183802293 22:40176971-40176993 CGGAGGCCAGGCAGGGTGGGAGG + Intronic
1183991553 22:41600377-41600399 CTGAGGAAAGGCAGCCTCGGGGG + Exonic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184179921 22:42813930-42813952 TTGGGTAAAGACAGAGTGGGAGG - Intronic
1184632432 22:45793743-45793765 CTGGGGAAAGGCAGGAATCGGGG - Intronic
1184664384 22:45979378-45979400 TTGGGGAAATGTGGGGTGGGAGG + Intergenic
1184729722 22:46365843-46365865 GGGGGGAAAGGTTGGGTGGGGGG + Intronic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1184852194 22:47127466-47127488 CTTGGGGAAGCCGGGGTGGGTGG - Intronic
1185111453 22:48902341-48902363 CTGGGGAGTGGCAGGCTGTGTGG + Intergenic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185407258 22:50660041-50660063 CTGTGGGAAGCCAAGGTGGGCGG + Intergenic
1203235131 22_KI270731v1_random:145539-145561 CTGGGGAAAGGAGGGCTGGGGGG - Intergenic
949306462 3:2647135-2647157 CTTTGGGAAGCCAGGGTGGGCGG + Intronic
949445637 3:4131317-4131339 CTGGGGAAGAGCAGGCAGGGTGG - Intronic
949707559 3:6836553-6836575 CTTGGGGAAGCCAAGGTGGGTGG - Intronic
949862627 3:8520480-8520502 TTTAGGAAAGGCAGGGTGGGAGG + Intronic
949961400 3:9315233-9315255 CTGGGAAAAGGTTGGGTGGGAGG - Intronic
950079280 3:10209607-10209629 CTGGAGAAAGGCCGGCTGGTGGG - Exonic
950486832 3:13278818-13278840 TTGGTGAGGGGCAGGGTGGGGGG + Intergenic
950552337 3:13674284-13674306 ATGGGGAAAGGAAGTGAGGGAGG - Intergenic
950637317 3:14324197-14324219 CTGGGGAAAGGAAGGAAGGGTGG - Intergenic
950774064 3:15334705-15334727 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
950983113 3:17330496-17330518 GTGGGAAATGGCAGGTTGGGAGG - Intronic
951078351 3:18424407-18424429 CGGGGGACAGCGAGGGTGGGGGG + Exonic
951403339 3:22262852-22262874 CTGGGGAGAAGCAGGCTAGGTGG - Intronic
951483807 3:23190315-23190337 CTGGTGTAAGACAGGGTTGGGGG - Intergenic
952304058 3:32129938-32129960 CTGGCGCCAGGCAGGGTGGGAGG - Intronic
952386318 3:32843876-32843898 CTCCACAAAGGCAGGGTGGGCGG - Intronic
952486630 3:33818349-33818371 CTTTGGGAAGGCAAGGTGGGCGG - Intronic
952920244 3:38278973-38278995 CTGGGGCAAGGCAGGGGCAGTGG - Intergenic
953001964 3:38943805-38943827 ATGGGGAAAGACTGGGTGAGAGG + Intronic
953258195 3:41310451-41310473 GCGGGGGAAGGCAGGGTGTGGGG + Intronic
953371483 3:42392261-42392283 ATGGGGAATGGCAGAGTGTGGGG + Intergenic
953456673 3:43047825-43047847 TTGAGGAAGGGCAGGTTGGGTGG - Intronic
953509782 3:43524364-43524386 CATGGGAAAGGTAGGGTAGGGGG - Intronic
954228677 3:49199605-49199627 TTGGGGAAAGGCGGGGGGAGGGG + Intronic
954464753 3:50647871-50647893 CTGGGGACAGACAGGATGGTGGG - Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954771638 3:52975443-52975465 CTGTGGGAAGGCAAGGCGGGAGG + Intronic
954877256 3:53810218-53810240 CTGGGGACAGTCAGGCTGGCTGG - Exonic
955055423 3:55450992-55451014 CTTGGCAAAGGCAGGCTGGGAGG - Intergenic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
955147619 3:56335870-56335892 TTGGGGAGAAACAGGGTGGGTGG + Intronic
955148325 3:56342071-56342093 GAAGGGAGAGGCAGGGTGGGAGG - Intronic
955679552 3:61486295-61486317 CTTTGGAAAGCCAAGGTGGGGGG - Intergenic
956111112 3:65870627-65870649 CAGGAGAGAGGCAGGGTGGGGGG + Intronic
956216196 3:66851919-66851941 CTGGAAAATGGCAGGGTTGGGGG + Intergenic
956606595 3:71079106-71079128 CAGGGGCAAGACAGAGTGGGTGG - Intronic
957792651 3:84959751-84959773 CTGGGGACAGGGAGACTGGGAGG - Intronic
959122049 3:102244205-102244227 CTGGGGCAAGGCTGGGATGGTGG + Intronic
959351378 3:105268973-105268995 CTCGGGAGAGGCCTGGTGGGAGG + Intergenic
959356325 3:105334044-105334066 AAGGGGAAAGGAAGGGAGGGAGG + Intergenic
959565123 3:107825968-107825990 CTGGAGAAAGCTTGGGTGGGAGG - Intergenic
960734621 3:120765024-120765046 TTGGGGATGGGGAGGGTGGGGGG - Intronic
960947005 3:122973808-122973830 GTGGGGAAGGGCAGAGAGGGAGG + Intronic
960973324 3:123154521-123154543 GTTGGGAAATGCAGGGTGGGGGG - Intronic
961328429 3:126125201-126125223 CTGGAGAGAAGCAGGGTGAGCGG - Intronic
961333503 3:126156628-126156650 CTGCTGAGAGGCAGGGTGGCAGG - Intronic
961811877 3:129526831-129526853 CAGGGCTAAGGCAGGGCGGGTGG - Intergenic
961848839 3:129794544-129794566 GTGGGAGAGGGCAGGGTGGGTGG + Intronic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962858235 3:139370045-139370067 CTGGGGAATGGGTGGATGGGGGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963884097 3:150561332-150561354 CTTTGGAAGGCCAGGGTGGGTGG + Intronic
963934170 3:151035402-151035424 CTGGGGGAAGGAAAGGTAGGAGG - Intergenic
964402557 3:156314458-156314480 CTGGAGTCAGGCAGGTTGGGTGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
965314261 3:167171631-167171653 CTGGGGAGAGTTAGGGTGGTAGG - Intergenic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
965765927 3:172129985-172130007 TTGGGGAGAGGGAGGGAGGGAGG + Intronic
965904735 3:173689724-173689746 ATGGGGCAAGGTAGAGTGGGAGG - Intronic
965926727 3:173989743-173989765 CGGGGAAAAGGAAGGGTGGGAGG - Intronic
966064143 3:175796100-175796122 TGGGGGAGAGGCAGGGTGGGTGG + Intronic
966281207 3:178231523-178231545 CTTTGGAAAGCCAAGGTGGGCGG - Intergenic
966925108 3:184639616-184639638 GCTGGGAAAGGCAGGGTGAGGGG + Intronic
966925865 3:184644240-184644262 CTTTGGAAGGTCAGGGTGGGTGG - Intronic
967171348 3:186825553-186825575 CTGGGCAGAGGCATGGCGGGAGG - Intergenic
967307665 3:188074817-188074839 CTGGGCAACGGCGGGGTGGGGGG + Intergenic
967817981 3:193815306-193815328 CTGGGGAAGGGAAGGGAAGGGGG - Intergenic
968171716 3:196515755-196515777 CTTGGGGAAGCCAAGGTGGGAGG + Intergenic
968296143 3:197577811-197577833 CTGGGGAATGGCTGTGGGGGAGG + Intergenic
968829521 4:2925663-2925685 CAGGGAGAAGGCAGGGAGGGAGG + Intronic
968831418 4:2934494-2934516 CCGGGGACGCGCAGGGTGGGGGG - Intronic
969109369 4:4832564-4832586 CGGGGGAAAGGGTGGGAGGGTGG + Intergenic
969200497 4:5600812-5600834 CTGAGCAAAGGATGGGTGGGGGG - Intronic
969228813 4:5815858-5815880 CTGGTGGAAGGAAGGGAGGGAGG + Intronic
969517912 4:7658773-7658795 CTGGTGCCAGGCAGGTTGGGAGG + Intronic
969835404 4:9836145-9836167 CGGGGGAAAGGGTGGGAGGGGGG + Intronic
970243396 4:14032802-14032824 CTGGGGAAAGGCAGTGAGCATGG - Intergenic
970690050 4:18611822-18611844 AAGGAGAAAGGCAGGGAGGGAGG + Intergenic
970690284 4:18612484-18612506 AAGGAGAAAGGCAGGGAGGGAGG + Intergenic
970690334 4:18612621-18612643 AAGGAGAAAGGCAGGGAGGGAGG + Intergenic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
972575558 4:40348170-40348192 CTGGCCAAAGGCCGGCTGGGTGG - Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
972807022 4:42539251-42539273 GGGGGGAGAGGAAGGGTGGGAGG + Intronic
973307362 4:48667889-48667911 CTTTGGGAAGCCAGGGTGGGTGG - Intronic
973712203 4:53641192-53641214 CTGGGGAAGGGCGGGGTGGGGGG + Intronic
973907635 4:55546956-55546978 CTGGGGAAAGGGAGAGTGAGGGG - Intronic
975102239 4:70526914-70526936 ACAGGGAAAGGCAGGGTTGGAGG - Intronic
975187165 4:71417318-71417340 CTAGGGAAAGTCAGGGAAGGTGG + Intronic
975409750 4:74036890-74036912 GTGGGGAACTGGAGGGTGGGGGG - Exonic
975673166 4:76802009-76802031 CTGGGGGAAGCCAGCGTGGGCGG - Intergenic
977324085 4:95553103-95553125 CTGGGCTAAGGCAGGGAAGGAGG - Intergenic
978059325 4:104316916-104316938 TGGGGGAAAGGGTGGGTGGGGGG + Intergenic
978726030 4:111970543-111970565 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
978818971 4:112943336-112943358 ATGGAGAGAGGCAGGGAGGGAGG - Intronic
979829789 4:125285213-125285235 CAGGGGAGAGGCCTGGTGGGAGG + Intergenic
980094298 4:128473578-128473600 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
980778005 4:137461798-137461820 TTAGGGAAAGGCAAGATGGGGGG - Intergenic
981130134 4:141149382-141149404 CTGGGGAAAGAGTGGGAGGGGGG - Intronic
981131200 4:141160343-141160365 CTGGGGAAATGCTGGTTGGCAGG + Intronic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
981421376 4:144554252-144554274 AAGGGGAATGGAAGGGTGGGTGG + Intergenic
982112912 4:152072625-152072647 CTTGGGAAAGGCAGATTGGAGGG + Intergenic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
983027421 4:162755545-162755567 GTGAGGGAAGGCAGGGTGGCAGG - Intergenic
983420139 4:167506680-167506702 GTGGGGCAAGCCAGGGTGGGTGG + Intergenic
983565874 4:169151218-169151240 ATGGGGAAATGGAGGGTGAGGGG + Intronic
983755128 4:171325741-171325763 TGGGGGAAAGGGTGGGTGGGGGG + Intergenic
983892590 4:173046038-173046060 CTGTGGGAAGCCAAGGTGGGAGG + Intergenic
983909307 4:173219123-173219145 CTCGGGAAAGACTGGGAGGGAGG - Intronic
984171063 4:176359841-176359863 CTGCAGAAAGGCATGGGGGGAGG - Intergenic
984304267 4:177966877-177966899 CTTTGGGAAGGCAAGGTGGGTGG - Intronic
984469989 4:180156410-180156432 CTGGGGAAGGGAAGGAAGGGAGG - Intergenic
984968531 4:185164972-185164994 CTGGGGAAAGGCCAGCAGGGAGG + Intronic
985096097 4:186414717-186414739 CTAAGGAAAGGAAGGGAGGGAGG + Intergenic
985359944 4:189162712-189162734 TAAGGGAAAGGCAAGGTGGGGGG + Intergenic
985370908 4:189284441-189284463 ATGGGGAAAGGAGGGGGGGGTGG + Intergenic
985511932 5:318164-318186 GGGGGGAGATGCAGGGTGGGAGG - Intronic
985511951 5:318216-318238 GGGGGGAGATGCAGGGTGGGGGG - Intronic
985511973 5:318268-318290 GGGGGGAGATGCAGGGTGGGGGG - Intronic
985639019 5:1054496-1054518 CTGGGGAAACGCTGGGCGGAGGG + Intronic
985657466 5:1139649-1139671 CTCGGGGAAGGCAGGCTGTGCGG - Intergenic
985673155 5:1216737-1216759 CTGGGGCCAGGGAGGCTGGGAGG - Intronic
985730457 5:1544544-1544566 CAGGAGAAAAGCAGGGAGGGAGG + Intergenic
986065375 5:4229585-4229607 CAGAGGAAGGGCAGGGTTGGCGG - Intergenic
986270682 5:6228185-6228207 CTGGGCAAAGGAGGGGTGTGCGG - Intergenic
986755589 5:10832884-10832906 CGGGGGAAGGGCAGGGGTGGGGG + Intergenic
986806128 5:11310656-11310678 CTGGGGAAAGGCAGAGAAAGAGG - Intronic
987141991 5:14955846-14955868 CTTTGGGAAGCCAGGGTGGGAGG - Intergenic
987277175 5:16374451-16374473 CTGGGGAAGGGCAGGCTGCCTGG - Intergenic
987327706 5:16827528-16827550 CTTTGGGAAGCCAGGGTGGGCGG - Intronic
988487993 5:31682839-31682861 CAGGGGAAAGGGAGGGGTGGAGG - Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989099896 5:37813804-37813826 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
990675590 5:58181161-58181183 TTGGGGACAGGGAGGGTGGGAGG + Intergenic
990759684 5:59114652-59114674 CAGGTCAAAGGAAGGGTGGGGGG + Intronic
991008782 5:61859785-61859807 CTTTGGAAGGTCAGGGTGGGCGG - Intergenic
991034318 5:62112851-62112873 CTGAGGAATGCCAGTGTGGGTGG - Intergenic
991510004 5:67365786-67365808 GTGCGAAAAGGCAGGGTGGGGGG + Intergenic
991946172 5:71900405-71900427 CTGGGGAAAAGAAGGCAGGGTGG - Intergenic
991965475 5:72086203-72086225 CTGGGGAAGGGTGGGTTGGGGGG + Intergenic
992072892 5:73164841-73164863 ATGGGGAGTGGTAGGGTGGGTGG + Intergenic
992377557 5:76203327-76203349 ATGGGTAAATGAAGGGTGGGTGG + Intronic
992534843 5:77689421-77689443 CTTGGGAAGGGGTGGGTGGGTGG - Intergenic
992785150 5:80163096-80163118 CTTTGGGAGGGCAGGGTGGGTGG - Intronic
992911364 5:81398906-81398928 CTGGGGAAAGCCAGGGAGGCAGG - Intergenic
993743766 5:91570516-91570538 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
994904564 5:105821583-105821605 CTTGGGAGAGGGAGGTTGGGAGG + Intergenic
995878789 5:116820994-116821016 CTGGGGAAGGGTAGGTAGGGTGG - Intergenic
995946012 5:117646812-117646834 CTGGGGAAGGGTTGGGTGGAGGG - Intergenic
996506292 5:124271099-124271121 ATGGGGAGAGGAAGGGAGGGAGG + Intergenic
996525458 5:124474381-124474403 CTTGGGGAAGCCAAGGTGGGTGG + Intergenic
997366494 5:133328695-133328717 CTGGTGACAGGGAGAGTGGGAGG - Intronic
997647133 5:135489111-135489133 CTGGGCAAGGGAAGGGAGGGAGG + Intergenic
997868800 5:137488906-137488928 TTGGGGAAAGGGAGGAAGGGCGG - Intronic
998170436 5:139869517-139869539 CTGGAGAAGGGCAGGGGGGTGGG - Intronic
998208373 5:140175434-140175456 CTGGGGAGGGGCAGGGAGGCAGG + Intronic
998240027 5:140432945-140432967 CTTTGGGAAGCCAGGGTGGGGGG - Intronic
998908414 5:146931674-146931696 CTGGGGATAAGTTGGGTGGGTGG + Intronic
999274975 5:150324176-150324198 CTGAGGATAGGCACGGTGGCAGG + Intronic
999687832 5:154118177-154118199 CTGTGGGAAGGCCGAGTGGGAGG - Intronic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
999798365 5:155009246-155009268 CTGGGGAGGGCCAGGGTAGGGGG - Intergenic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1000731242 5:164836339-164836361 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1000732724 5:164856266-164856288 CTGATGAAAGTCTGGGTGGGTGG - Intergenic
1000738400 5:164934024-164934046 CTGGGGGAAGGCGGGGTTGTGGG - Intergenic
1001003923 5:168032737-168032759 CTGAGGAAAGGCTGGAAGGGAGG - Intronic
1001048420 5:168394108-168394130 CTGGGGAAGGGAAGGAAGGGAGG + Intronic
1001075668 5:168626107-168626129 CTTGGGGAAGCCAAGGTGGGAGG - Intergenic
1001316978 5:170650327-170650349 GTGGGGGATGGCAGGGTGGGAGG - Intronic
1001336160 5:170798614-170798636 CTTGGGAGAGTAAGGGTGGGTGG - Intronic
1001404971 5:171469798-171469820 GTGGGGAGGGGCAGGGGGGGCGG - Intergenic
1001500028 5:172224197-172224219 CTAGGGAGAGGCCTGGTGGGAGG + Intronic
1001689883 5:173625149-173625171 ATGGGGAGAGGTAGGTTGGGAGG - Intergenic
1001748133 5:174107615-174107637 GCGGGGCAGGGCAGGGTGGGGGG + Exonic
1001820434 5:174705948-174705970 GTGGAGAGAGGCAGGGAGGGTGG - Intergenic
1001940363 5:175735861-175735883 ATGGGGAGAAGCTGGGTGGGCGG - Intergenic
1002036561 5:176475373-176475395 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1002093397 5:176817561-176817583 GTGGGGAGGGGCGGGGTGGGGGG - Intronic
1002469044 5:179423815-179423837 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1002476714 5:179470439-179470461 CTTGGGGAAGGCAGGATGAGGGG + Intergenic
1002854820 6:1027340-1027362 CTGGGGGCAGGAAGGATGGGAGG + Intergenic
1002902707 6:1423494-1423516 GTGGGGAGAGGTAGGGAGGGTGG - Intergenic
1002904730 6:1438987-1439009 CAGGGTAAAGGCTGGGTGGGGGG - Intergenic
1002980100 6:2127714-2127736 CTGGGGAAAGGACGAGGGGGCGG - Intronic
1003146537 6:3514815-3514837 CTGGGGAGAGGCTGGGGTGGAGG + Intergenic
1003186863 6:3839742-3839764 CTGGGGTATGGGAGGGAGGGAGG - Intergenic
1003310424 6:4965407-4965429 CTGGGGTGGGGCAGAGTGGGAGG - Intergenic
1003465570 6:6376860-6376882 CTGGGCAGCGGCGGGGTGGGTGG - Intergenic
1003727636 6:8783575-8783597 CTGGGTAAAGGCTGGGAGGTGGG - Intergenic
1003955574 6:11162206-11162228 ATGGGAAAGGGCAGGGTGTGTGG + Intergenic
1004424235 6:15496860-15496882 CGGCGGCAAGGCCGGGTGGGCGG + Exonic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005135002 6:22557777-22557799 CTGGAGAAAGGCTGAATGGGTGG + Intergenic
1005414668 6:25587030-25587052 CTGGGGAAAGGGAGAGGGAGGGG + Intronic
1005488531 6:26324161-26324183 CTGGGGGAAGGAAGGGAGGAAGG + Intergenic
1006045051 6:31288057-31288079 CTGGGGTAAGGCAGGGAAGTGGG + Intronic
1006173888 6:32110264-32110286 GTGGTGGAAAGCAGGGTGGGGGG + Intronic
1007175234 6:39891763-39891785 TCTGAGAAAGGCAGGGTGGGTGG + Intronic
1007521074 6:42452213-42452235 AAGGAGAAAGGCGGGGTGGGGGG + Intergenic
1007595396 6:43048109-43048131 CTGGGGAGAGGCTGGGGGAGAGG - Intronic
1007607759 6:43128941-43128963 CAGGGGAGAGGCAGGGTCAGGGG - Intronic
1007615381 6:43176690-43176712 GTGGGGGAAGGCAGGGAGGGAGG - Intronic
1007679905 6:43626887-43626909 CTGGGGAAAAGCAGGGGCTGGGG - Intronic
1007840879 6:44714956-44714978 TTGGGCAAAGGCTGGGTGAGGGG + Intergenic
1008362344 6:50635560-50635582 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1008418793 6:51273089-51273111 GTGGTGAAAGGCAGGGCTGGAGG + Intergenic
1008489833 6:52074879-52074901 CTGGGGAAAGGATTGGTGGCGGG - Intronic
1008627938 6:53335976-53335998 CTTATGAAAGGCAGGGTGGATGG - Intronic
1008911263 6:56736131-56736153 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1010268098 6:73890529-73890551 CAGGGGAAGGGCTTGGTGGGAGG + Intergenic
1010331649 6:74630073-74630095 GTGGGGAGAGGCAGAGTGGGGGG - Intergenic
1010809133 6:80278811-80278833 ATGGGGAAAGGCACTTTGGGAGG - Intronic
1011001254 6:82590753-82590775 CTGGGGAATTTCAGGGTGGGAGG + Intergenic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011423973 6:87205315-87205337 CTTGGGGAAGCCAAGGTGGGAGG - Intronic
1011428136 6:87253155-87253177 CTTTGGGAAGGCAAGGTGGGAGG - Intronic
1012426841 6:99124212-99124234 CTTGGGAAAGGAAGGGGAGGGGG - Intergenic
1013439430 6:110147853-110147875 CTTGGGAAACTGAGGGTGGGAGG - Intronic
1013747435 6:113362539-113362561 CTGGGGAAAGACAACGTGGCAGG + Intergenic
1013869924 6:114744463-114744485 CTGGGGAATGAAAGGGTGTGTGG + Intergenic
1013913404 6:115306035-115306057 CAGGGGAAAGGGTGGGAGGGAGG - Intergenic
1014196237 6:118562937-118562959 CTTGGGGAAGGTAGGGTGGAAGG - Intronic
1014199381 6:118591338-118591360 CACAGAAAAGGCAGGGTGGGAGG - Intronic
1014727100 6:124984301-124984323 CTTTGGGAAGGCAAGGTGGGTGG + Intronic
1015059793 6:128949318-128949340 CTGGGGCAGGGTGGGGTGGGTGG - Intronic
1015283552 6:131459499-131459521 CTTTGGAAAGGCAAGGCGGGTGG + Intergenic
1015934689 6:138396960-138396982 CCGGGGAAGGGCCTGGTGGGAGG - Intergenic
1015975544 6:138786857-138786879 CTTGGGGAGGCCAGGGTGGGCGG - Intronic
1016158797 6:140849582-140849604 CTGGGGAAACGTAGGGATGGTGG - Intergenic
1016563127 6:145419183-145419205 CTGGGGAAAGGAGCGGGGGGGGG - Intergenic
1016696031 6:146997552-146997574 CTTTGGAAAGCCAAGGTGGGTGG + Intergenic
1016880351 6:148905339-148905361 CTAGTGAAAGGCAGACTGGGTGG + Intronic
1017052554 6:150407362-150407384 GTGGGGAATGGCAGGGTAAGTGG + Intergenic
1017472257 6:154750451-154750473 TGGGGGAAAGGGAGGGAGGGAGG - Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017570893 6:155742870-155742892 GTGGGGAGTGACAGGGTGGGGGG + Intergenic
1018433876 6:163744256-163744278 CAGGGGAGAGGCAAGGAGGGAGG - Intergenic
1018448768 6:163885448-163885470 CCTGGGAAAGGCTGTGTGGGAGG - Intergenic
1018657392 6:166051526-166051548 CTGGGGTTAGGGATGGTGGGGGG - Intergenic
1018666242 6:166141027-166141049 CTCGTGAAAGGGAGGGAGGGAGG + Intergenic
1019082752 6:169446272-169446294 CAGGTCAGAGGCAGGGTGGGGGG + Intergenic
1019113714 6:169739288-169739310 CATGGGAAGGCCAGGGTGGGAGG - Intergenic
1019215169 6:170438774-170438796 CTGGGGATCAGCAGGCTGGGGGG + Intergenic
1019340026 7:504552-504574 CTGGGAGATGGCAGGGTGTGAGG - Intronic
1019386299 7:758046-758068 CTGGGGTAAGGAAGGGAGCGGGG + Intronic
1019391137 7:787352-787374 TTGGGGGGAGTCAGGGTGGGAGG + Intergenic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019491570 7:1316238-1316260 CTGTGGGCAGGCAGAGTGGGTGG + Intergenic
1019501315 7:1366261-1366283 CTGCTGCAAGGCAGGGTGGCAGG + Intergenic
1019548669 7:1591447-1591469 CAAGGAAAAGGCAGGCTGGGCGG - Intergenic
1019596951 7:1862495-1862517 GAGGGGCAAGGCAGGGAGGGAGG - Intronic
1019639610 7:2096455-2096477 CTGTGGAAAAGCAGCGTAGGAGG - Intronic
1019641359 7:2105468-2105490 CTGGGGCAAGGCAGGGAGCGTGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019712550 7:2524254-2524276 CGGGGGACAGGCGGGGTGGCGGG - Intronic
1019785876 7:2977117-2977139 CTGGGGGGAGGCAGGGATGGAGG + Intronic
1019866257 7:3713045-3713067 CTGGGGCATGGCAGGGTGCCAGG + Intronic
1019950756 7:4370423-4370445 CTGGGGAAATGAAGGTTGGAAGG + Intergenic
1020034359 7:4955807-4955829 CTTTGGAAAGCCAAGGTGGGTGG + Intronic
1020087924 7:5321419-5321441 CTGGGGCCAGGCAGGGGAGGGGG - Intronic
1020470447 7:8528305-8528327 CTGGGGGGAGCCAGAGTGGGTGG + Intronic
1020749415 7:12121913-12121935 CTGGGGCCTGTCAGGGTGGGTGG - Intergenic
1021585866 7:22207451-22207473 CTGGGGACAGCCAGGGGGTGGGG + Intronic
1022091998 7:27113898-27113920 CTCGGGAAGGGCAGGGGGCGGGG - Intronic
1022138571 7:27472527-27472549 CTGGGGGATGGCGGGGGGGGTGG - Intergenic
1022368671 7:29750219-29750241 GGGAGGAAAGGCAGAGTGGGCGG - Intergenic
1022430363 7:30313512-30313534 CAGTAGAAAGGCAGGGAGGGAGG - Intronic
1022469784 7:30675098-30675120 CTGGGGCAAGGGAGAGTGGGAGG - Intronic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022881360 7:34591395-34591417 CTGGGGAGAGGCCTGGTGGGAGG - Intergenic
1023022648 7:36024081-36024103 CTCTGGAAGGCCAGGGTGGGAGG - Intergenic
1023027297 7:36062238-36062260 CTGGGGACAGGCAGGGAAAGCGG + Intergenic
1023119545 7:36895250-36895272 GTGGGGAAGCTCAGGGTGGGAGG + Intronic
1023179326 7:37465815-37465837 CTTTGGAAGGCCAGGGTGGGTGG + Intergenic
1023362478 7:39430863-39430885 CTGGGGAAGGCCAGAGTGGATGG + Intronic
1023666734 7:42530436-42530458 CTTGTGAAAGGCAGGGCTGGTGG - Intergenic
1023958333 7:44905812-44905834 GTGGGGACAGCCAGGGTGAGTGG - Intergenic
1024061145 7:45699602-45699624 CTGGGGGACGGGAGGGTGGGAGG + Intronic
1024142431 7:46475722-46475744 CAAGGTCAAGGCAGGGTGGGGGG + Intergenic
1024242499 7:47446508-47446530 CTGGGCAGAGGCTGGGTGGGAGG - Intronic
1024560123 7:50637083-50637105 CTTGGGGAAGGTAAGGTGGGAGG - Intronic
1024709215 7:51996245-51996267 CTGAGGACAGCCAGGCTGGGAGG - Intergenic
1024859623 7:53823572-53823594 CTGGTGAAAGGGAGACTGGGTGG + Intergenic
1025264956 7:57449257-57449279 CTGGGGATGGGGAGGGTAGGGGG + Intergenic
1025556771 7:62319156-62319178 AAGGGGAAAGGAAGGGAGGGAGG - Intergenic
1026144501 7:67734808-67734830 CTGGGGGAAGGCAGTGTAGAAGG - Intergenic
1026845669 7:73697707-73697729 CTGGGAGCTGGCAGGGTGGGTGG + Intronic
1026873925 7:73869195-73869217 CGGGGCATGGGCAGGGTGGGGGG + Intergenic
1026984163 7:74544654-74544676 CTGGGGAATGGCAGGCCAGGGGG - Intronic
1026986091 7:74555863-74555885 CTTGGGAAGGTCAAGGTGGGAGG + Intronic
1027049127 7:75010562-75010584 CTGGGGAATGGCAGGGTCGAGGG - Intronic
1027189570 7:75989061-75989083 CCGGGGGAAGGCTGGGTGGAGGG + Intronic
1027923345 7:84426069-84426091 CTCAGGAAGGGAAGGGTGGGAGG + Intronic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1028816495 7:95152191-95152213 CTGTGGAAAGCCAAGGCGGGTGG - Intronic
1029110392 7:98210931-98210953 ATGGGGAAAAGCAGGTTGTGGGG + Intergenic
1029111927 7:98217101-98217123 GAGGGGAAGGGAAGGGTGGGAGG + Exonic
1029146168 7:98447635-98447657 CTTTGGAAAGCCAAGGTGGGAGG + Intergenic
1029158882 7:98537086-98537108 AGGGGGAAAGGGAGGATGGGAGG + Intergenic
1029197072 7:98812521-98812543 CTTTGGAAAGCCAGGGTAGGAGG + Intergenic
1029383893 7:100231085-100231107 CTGGGGAATGGCAGAGTCGAGGG + Intronic
1029435535 7:100562204-100562226 CTGAGGTAAGACAGGGCGGGAGG - Intronic
1029514010 7:101014719-101014741 CTTTGGGAAGCCAGGGTGGGTGG - Intronic
1029690404 7:102177589-102177611 CAGGGGAACAGCAGAGTGGGTGG - Intronic
1029803213 7:102971780-102971802 CTTTGGAAAGCCAAGGTGGGCGG + Intronic
1029891346 7:103933484-103933506 CAGGAGAAAGGAAGGGAGGGAGG + Intronic
1030035305 7:105403756-105403778 CTGTCGAAAGGAAGGGAGGGAGG - Intergenic
1030087612 7:105830416-105830438 ATGGGGCAGGGCTGGGTGGGAGG - Intronic
1031296504 7:120010440-120010462 CTGGGGAGAGGCAGGAGGGAAGG - Intergenic
1031307852 7:120155404-120155426 CTGGGAAGTGGCAGGGTGAGGGG + Intergenic
1031484046 7:122307184-122307206 CTGGGGCAAAGGGGGGTGGGGGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031745619 7:125494257-125494279 GTGGGGAAAGGAAGGGAGTGGGG - Intergenic
1031960481 7:127985097-127985119 GTGGGGAATGGCAGAGAGGGAGG - Intronic
1032020984 7:128406998-128407020 ATGGGGAAAGGTGGGGTGGTAGG + Intronic
1032054495 7:128673511-128673533 CTAAGGAAAGGCAGGGAGGCTGG + Intronic
1032395819 7:131588885-131588907 CTGGGTGCAGGCAGGGTGGCAGG - Intergenic
1032546916 7:132751424-132751446 CTGGGGCCAGGCAGGGTCCGAGG - Intergenic
1033131995 7:138752617-138752639 CTGGAGCAAGGCATGGTGCGTGG - Exonic
1033140875 7:138825295-138825317 CTGGGGAGAGGCAGAGTGCGAGG - Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033314975 7:140289648-140289670 CTTTGGGAAGCCAGGGTGGGTGG + Intergenic
1033943235 7:146681500-146681522 GTGGGGAGTGGGAGGGTGGGAGG + Intronic
1034313404 7:150109969-150109991 CTGGGGACAGTCATGGAGGGAGG + Intergenic
1034361959 7:150507342-150507364 TTGGGGAAAGGGTGGGAGGGAGG + Intergenic
1034422853 7:150998456-150998478 CTGGGGCCTGGCATGGTGGGGGG - Intronic
1034433797 7:151053603-151053625 CTGGGCAGAGGAAGGGAGGGTGG + Intergenic
1034554144 7:151839304-151839326 CTGGGGCAAGGCAGCGTGGCCGG + Intronic
1034781288 7:153885067-153885089 ATGGGAAAAGGCAGGTTGTGGGG + Intergenic
1034793457 7:153990695-153990717 CTGGGGACAGTCATGGAGGGAGG - Intronic
1035022024 7:155805785-155805807 TTGGGGAGAGGCCTGGTGGGCGG - Intronic
1035395284 7:158530885-158530907 CAGGGGAATGGCAGGCTGGGGGG + Intronic
1035482144 7:159195777-159195799 CTGGGGAGAGGGAGGGATGGGGG + Intergenic
1035777861 8:2203411-2203433 CTGGGAAAAGCCACGGCGGGGGG - Intergenic
1036083830 8:5590831-5590853 CTGTGTAAAGGAAGGGTTGGAGG - Intergenic
1036088434 8:5638332-5638354 CTGGGCAAAGTCAACGTGGGGGG + Intergenic
1036381591 8:8239441-8239463 CTGGGGGATGGCAGAGGGGGAGG - Intergenic
1036712618 8:11091185-11091207 CTTGGGAGAGACAAGGTGGGAGG + Intronic
1036977611 8:13431759-13431781 CTTGGGAAAGGGAACGTGGGTGG + Intronic
1037041651 8:14243806-14243828 CTGAGGAACTGAAGGGTGGGAGG - Intronic
1037168844 8:15865247-15865269 CTTTGGAAAGCCAAGGTGGGCGG - Intergenic
1037319979 8:17632762-17632784 CTGGGGAGAGGAGGGGAGGGAGG - Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037597877 8:20369561-20369583 ATGGGCAAAGACTGGGTGGGAGG - Intergenic
1037806193 8:22059021-22059043 GTGGGGAGGGGCAGGGAGGGTGG - Intronic
1037820434 8:22132384-22132406 CTGTGGCAAGGCAGGCTGGTAGG + Intronic
1037838925 8:22230532-22230554 CTGGGGAAGGGCAGGGTGTGAGG + Intronic
1037885871 8:22596036-22596058 CTTTGGAAAGCCAAGGTGGGAGG - Intronic
1038216607 8:25567406-25567428 GAGGGGAATGGCGGGGTGGGCGG + Intergenic
1038395750 8:27244306-27244328 CTTGGGAAAGGGAAGGTGAGAGG - Intronic
1038397525 8:27258101-27258123 CTCAGGAGAGGCAGGATGGGTGG - Intronic
1038493163 8:27984100-27984122 GTGGGGCCAGGCAGGGAGGGAGG - Intronic
1038755668 8:30338565-30338587 CTTTGGAAAGTCAGGGTGGGAGG + Intergenic
1039226330 8:35392460-35392482 CTTTTGAAAGGCAAGGTGGGAGG - Intronic
1039382941 8:37102852-37102874 TTGGGGAGAGGGAGGATGGGTGG - Intergenic
1039572502 8:38599058-38599080 CAGGGGAAAGGGTGGGAGGGGGG - Intergenic
1039619461 8:38983291-38983313 CTTTGGAAGGCCAGGGTGGGTGG + Intronic
1039803244 8:40977848-40977870 CTGGAAAAAGGCAGGGCAGGAGG - Intergenic
1039812653 8:41063380-41063402 AAGGGGAAAGGGAGGGAGGGAGG + Intergenic
1039928528 8:41961249-41961271 TTGGTGAAAGGCAGGATGTGTGG - Intronic
1040421317 8:47242758-47242780 CTGGTGAACCGCAGTGTGGGTGG - Intergenic
1040656796 8:49519772-49519794 CTGTGGGAGGCCAGGGTGGGAGG - Intergenic
1040798022 8:51308390-51308412 CTGGGGAGGGGCCTGGTGGGAGG + Intergenic
1040809885 8:51440273-51440295 CGGGGGAAAGGATGGGAGGGTGG + Intronic
1041467500 8:58171720-58171742 CTAGGACAAGGCGGGGTGGGGGG - Intronic
1041849167 8:62368561-62368583 CTGGGGAAGGGCATGAAGGGGGG + Intronic
1042214198 8:66413052-66413074 CGGGGGAAAGGGTGGGAGGGGGG - Intergenic
1042601652 8:70504699-70504721 CTTTGGAAAGCCAAGGTGGGAGG - Intergenic
1042996022 8:74699630-74699652 TTGGGGAAAGGCTGGGAGGTGGG + Intronic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043097902 8:75999191-75999213 ATGGGGAAAGACAAGGTGGAAGG - Intergenic
1043775676 8:84265431-84265453 CTGAGGCAAGGAATGGTGGGTGG + Intronic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1043908335 8:85833088-85833110 ACGGGGAAGGGAAGGGTGGGAGG - Intergenic
1044693355 8:94899994-94900016 CTGGGGAAAGGCAATGGAGGTGG - Intronic
1044935567 8:97290446-97290468 GTGGGGAAAGACAGGGATGGGGG + Intergenic
1045162524 8:99564487-99564509 CTGGGGTAAGGCCGGGAGGCTGG + Intronic
1045656797 8:104395240-104395262 CTTTGGAAAGCCAAGGTGGGTGG - Intronic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046572639 8:115985934-115985956 CTTTGGGAAGCCAGGGTGGGGGG - Intergenic
1046889888 8:119411301-119411323 CTGGGGGAAGTCAGGAGGGGAGG - Intergenic
1046898334 8:119497170-119497192 GTGGGCAAAGGCAGGCTGAGTGG - Intergenic
1047241728 8:123096207-123096229 CAGGGGAAATGAGGGGTGGGGGG - Intronic
1047242272 8:123101654-123101676 CTGTGGGAAGCCAAGGTGGGTGG - Intronic
1047465799 8:125112734-125112756 TTGGGGAAGGGAAGGGTGGGAGG + Intronic
1047820984 8:128520486-128520508 CTTGAGAAAGGCAGGCTGGCAGG - Intergenic
1047872603 8:129101559-129101581 CTGGGGAAAGGCAGCGAGGTGGG - Intergenic
1047947599 8:129897645-129897667 GTAGGGAGAGGCATGGTGGGCGG + Intronic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1047971905 8:130091919-130091941 CTGGGGCCAGGCAGCGTGTGGGG - Intronic
1048049744 8:130805961-130805983 CTGGGGAAAGACAGGGTCACTGG - Intronic
1048432333 8:134381970-134381992 CTGGGCCAAGGCAGAGTGGTGGG - Intergenic
1048822255 8:138391208-138391230 CTGGTGAAATGCAGGGTGGCAGG + Intronic
1049070411 8:140351232-140351254 CTAGGGGCAGGCAGCGTGGGGGG - Intronic
1049070605 8:140352690-140352712 CTGGGGAAGGGGTGAGTGGGAGG - Intronic
1049361072 8:142212851-142212873 TTGGAGAAAGGCGGGGAGGGAGG - Intronic
1049415968 8:142495291-142495313 CATGGGAAAGGGTGGGTGGGCGG + Intronic
1049432798 8:142573144-142573166 CTGGGGAGCGGCAGTGAGGGTGG - Intergenic
1049595948 8:143483426-143483448 CTGGGGCAATGCAGGGGAGGTGG + Intronic
1049664358 8:143836430-143836452 GTGGGGAAAGGGAGGTTGGGCGG + Intronic
1049696414 8:143986273-143986295 CTGGGGAGGGGCAGGAGGGGTGG - Intronic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1049902548 9:183365-183387 CTTTGGAAAGCCAGGGCGGGTGG + Intergenic
1050609022 9:7331868-7331890 CTGGGGCCAGGCAGGGAGAGAGG - Intergenic
1050747393 9:8892173-8892195 CTGAGGAAAAGCAGCGTGGATGG - Intronic
1051142053 9:13988201-13988223 CTGTGGAAAGCCAGGGTGAATGG - Intergenic
1051154231 9:14123003-14123025 CTGTGGGAGGTCAGGGTGGGTGG + Intronic
1051558151 9:18408223-18408245 CTTTGGGAAGCCAGGGTGGGAGG + Intergenic
1052482967 9:29055710-29055732 CTGGTGAAAGGGTGGGAGGGAGG - Intergenic
1052642346 9:31184989-31185011 ATGGCAAAAGGGAGGGTGGGAGG + Intergenic
1052847253 9:33348021-33348043 CTGGGGAAAGGACGGGAGGCGGG + Intronic
1053148351 9:35727237-35727259 ATGGGGAAAAGCAGGGTGAGAGG + Intronic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053562204 9:39208235-39208257 CTGTGGTGAGGCAGGGTTGGGGG + Intronic
1053745571 9:41193654-41193676 CTTTGGAAAGCCAGGGCGGGTGG + Intronic
1053828011 9:42046236-42046258 CTGTGGTGAGGCAGGGTTGGGGG + Intronic
1054134914 9:61410723-61410745 CTGTGGTGAGGCAGGGTTGGGGG - Intergenic
1054481700 9:65671561-65671583 CTTTGGAAAGCCAGGGCGGGTGG - Intronic
1054602546 9:67141210-67141232 CTGTGGTGAGGCAGGGTTGGGGG - Intergenic
1054682771 9:68237617-68237639 CTTTGGAAAGCCAGGGCGGGTGG - Intronic
1055485983 9:76756830-76756852 CAGGGCACGGGCAGGGTGGGTGG - Intronic
1055791922 9:79931580-79931602 CTGGAGAGAGGCAGGGTGGAGGG + Intergenic
1056118102 9:83460979-83461001 GTGGGGACAGCCAGGGTGAGAGG + Intronic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056198258 9:84249590-84249612 CTGGGGAAGGCCAGGGGGGTGGG + Intergenic
1056251394 9:84751963-84751985 CTAGAGAAAGGAAGGGAGGGTGG - Intronic
1056262681 9:84864348-84864370 GTGGGGAAAGGGTGGGAGGGGGG + Intronic
1056451480 9:86721440-86721462 TTAGTCAAAGGCAGGGTGGGTGG + Intergenic
1056488100 9:87079084-87079106 CTGTCGGAGGGCAGGGTGGGTGG + Intergenic
1056604639 9:88076642-88076664 CAGGGGAAATGAAGGGAGGGTGG - Intergenic
1057030823 9:91773941-91773963 CTGGGGAAAGGCAAGCTGTCAGG - Intronic
1057181996 9:93035350-93035372 CTGGGGAGAGGGATGGTGCGGGG - Exonic
1057221579 9:93260418-93260440 CTGGGGTAAGGCCAGGTAGGAGG - Intronic
1057305202 9:93908333-93908355 CTGGAGCAAGGCAGGCAGGGGGG + Intergenic
1057777278 9:98021229-98021251 CTTGGGAAAGGCTGGGGGTGAGG + Intergenic
1057817188 9:98304303-98304325 AAGGGGAAGGGCAGGCTGGGTGG + Intronic
1057852703 9:98577572-98577594 GTGTGGAAAGGCAGGGTGTCTGG + Intronic
1057881385 9:98795563-98795585 CTGTGGGAAGGCATGATGGGAGG - Intronic
1058221616 9:102310184-102310206 CTGGGGAAAAGCTGAGTGAGGGG - Intergenic
1059363867 9:113770218-113770240 CTTTGGAAAGCCAAGGTGGGTGG - Intergenic
1059399827 9:114061951-114061973 GGGAGCAAAGGCAGGGTGGGTGG - Intronic
1059423871 9:114208912-114208934 GTGAGGAAAGGCTGGGAGGGAGG + Intronic
1059427666 9:114231226-114231248 CTGGGGGAAGGGAGGATGGCAGG + Intronic
1059734231 9:117085687-117085709 TTGGGGAAAGGTAGCCTGGGAGG - Intronic
1060292637 9:122318501-122318523 CTGGTGGAAGGCAGGGAGGCTGG + Intronic
1060370715 9:123068104-123068126 CTTTGGGAAGCCAGGGTGGGTGG + Intronic
1060372398 9:123086690-123086712 AGGGAGAAAGGGAGGGTGGGAGG + Intronic
1060690889 9:125659004-125659026 CTTTGGAAAGGCAAGGTGGGAGG + Intronic
1060768048 9:126309647-126309669 CTGGGGAGAGGGAGGGTGCTGGG - Intergenic
1060776423 9:126378119-126378141 CTGGGGTAAGGTGGGGTGTGGGG - Intronic
1060894145 9:127206911-127206933 CTGGGAAGAGGCAGAGTAGGTGG - Intronic
1061275279 9:129566618-129566640 GTGAGGAGAGGCAGGGCGGGAGG - Intergenic
1061293407 9:129665179-129665201 CGGGGGAGAGGCGGGGTGGGGGG + Intergenic
1061577158 9:131514311-131514333 CTGGGGGGAGCCAGGGTGGCGGG - Intronic
1061731392 9:132617137-132617159 CTCGAGGAAGGCAGTGTGGGTGG - Intronic
1061791338 9:133060839-133060861 CTGGGGAAAGGACTGGAGGGTGG - Intergenic
1061795016 9:133081406-133081428 CTGGGGAAAGGACTGGAGGGTGG - Intronic
1061867165 9:133498839-133498861 CTGATGAAAGACAAGGTGGGAGG + Intergenic
1061957751 9:133972375-133972397 CTGGGGCAGGGCAGGGGTGGGGG + Intronic
1062056927 9:134473616-134473638 CGGAGGCAAGGCAGGCTGGGAGG + Intergenic
1062146391 9:134992110-134992132 CTGGGGAAGGGCTGGGAGGGAGG + Intergenic
1062183481 9:135203575-135203597 CTGGGGAAAGACAGCAGGGGTGG - Intergenic
1062370497 9:136236292-136236314 CTGGGGAGACGCACGGTGTGCGG + Intronic
1062552925 9:137098382-137098404 CTGGAGAACGGGAGGGTGAGTGG - Intronic
1062573231 9:137195003-137195025 GTGTGCACAGGCAGGGTGGGTGG - Intronic
1062622333 9:137428651-137428673 CAGGGGAGGGGCCGGGTGGGGGG + Intronic
1062622365 9:137428725-137428747 TGGGGGAGAGGCTGGGTGGGGGG + Intronic
1062643846 9:137536334-137536356 GTAGGGGAAGGAAGGGTGGGTGG + Intronic
1062671318 9:137711611-137711633 CTGCAGAGAGGCAGGGTGAGGGG + Intronic
1062698629 9:137887985-137888007 CAGGGGAGAGGCTGGGAGGGTGG + Intronic
1202781704 9_KI270718v1_random:4435-4457 CTTTGGAAAGCCAGGGCGGGTGG + Intergenic
1203736814 Un_GL000216v2:144832-144854 CCGGGGGAAGGCAGTGGGGGTGG - Intergenic
1185493813 X:539130-539152 CTTTGGGAAGGCAAGGTGGGTGG + Intergenic
1185593679 X:1294550-1294572 CTGGGGGAAGGATGCGTGGGTGG + Intronic
1185633154 X:1531452-1531474 CTGGGCACAGTCAGGCTGGGAGG - Intronic
1186043315 X:5505399-5505421 TTGGGAAAAGCCAGGGTGGGTGG - Intergenic
1186122877 X:6382463-6382485 CTGGGGCAAGGAGGGGTGAGTGG - Intergenic
1186320256 X:8416459-8416481 TTTGGGAAGGACAGGGTGGGAGG + Intergenic
1187126535 X:16459553-16459575 CTAGGTAAAGGCAGGTGGGGTGG - Intergenic
1187174310 X:16882643-16882665 CTGGGGAGGGGCGGGGCGGGGGG - Intergenic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1187709228 X:22037362-22037384 ATGGGGAGAGGGATGGTGGGAGG - Intronic
1188202520 X:27308752-27308774 TTGGGGAAAAGCAGGCTGTGAGG + Intergenic
1188595347 X:31893570-31893592 AAGGGGAAAGGGAGGGAGGGAGG + Intronic
1188774344 X:34194906-34194928 CTGGGGTGAGGGAGGGAGGGAGG - Intergenic
1188987082 X:36777585-36777607 CTGAGGAAGGGCATGGTAGGAGG - Intergenic
1189333019 X:40154584-40154606 CTGGAGAAAGGTGGGGTGGGGGG - Intronic
1189458590 X:41217640-41217662 CTTTGGGAAGCCAGGGTGGGAGG + Intronic
1189601027 X:42626373-42626395 CTGGGGGAAGACAGTATGGGTGG + Intergenic
1189710727 X:43809045-43809067 CTGGGGAAAGGAAGGAGGGATGG - Intronic
1190054365 X:47173307-47173329 CTGGGAATGGGCAGCGTGGGGGG + Intronic
1190279847 X:48922451-48922473 CTGGGCAAGGGCAGGGCGGCAGG - Exonic
1190356233 X:49608212-49608234 CAGGGGAAATGCGGGGTAGGAGG - Exonic
1190685751 X:52871273-52871295 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
1190940004 X:55031028-55031050 CCGGCAGAAGGCAGGGTGGGTGG - Exonic
1191918609 X:66229446-66229468 CAGGGGAAAGGGTGGGAGGGAGG + Intronic
1192033954 X:67544353-67544375 GGGGGGGAAGGCAGGGTGGGGGG - Intronic
1192356752 X:70411181-70411203 CTTGGGGAAGCCAAGGTGGGAGG + Intronic
1192456551 X:71281233-71281255 CTGGGCATAGGCACGGTGGCAGG + Intergenic
1192533961 X:71911976-71911998 CTGGGGAGTGGCCGGGAGGGGGG + Intergenic
1192616292 X:72626184-72626206 GGGGGGAAAGGCAGGAAGGGAGG + Intronic
1192698641 X:73445205-73445227 CAGGTGAATGGCAGTGTGGGTGG - Intergenic
1192759723 X:74084659-74084681 TTGGGGCAAGGCTGGGTGGGTGG - Intergenic
1192994836 X:76502155-76502177 CTGGGGACTGTCAGGGTGTGGGG + Intergenic
1193765342 X:85521895-85521917 CTGGGGAAGGGTCTGGTGGGAGG + Intergenic
1194390604 X:93312947-93312969 CTGAGAAACGGCGGGGTGGGGGG + Intergenic
1195197865 X:102516832-102516854 GAGGGGAAGGGCGGGGTGGGGGG - Intergenic
1195236087 X:102900072-102900094 CAGGGGAAAGGGAGGGATGGAGG - Intergenic
1195250066 X:103034931-103034953 CTGGGGAAACGTAGTGTGGAGGG - Intergenic
1195289685 X:103420196-103420218 ATGGTGAAAGGCAGAGTGGGAGG + Intergenic
1195865246 X:109425645-109425667 CGGGGGAAAGGGTGGGAGGGGGG + Intronic
1195929168 X:110056169-110056191 TGGGGGAAAGGTAGGGAGGGGGG - Intronic
1195976669 X:110534633-110534655 CTTTGGGAAGCCAGGGTGGGAGG + Intergenic
1196417704 X:115489673-115489695 CAGGGGAGGGGCATGGTGGGAGG + Intergenic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1196922776 X:120601711-120601733 CTGGGGAGAGACCTGGTGGGAGG + Intronic
1197022223 X:121705429-121705451 CTAGGGCAAGGCAGAGTGAGAGG + Intergenic
1197751883 X:129970175-129970197 CTCGGGAAAGGGTGGGAGGGAGG - Intergenic
1198596402 X:138240781-138240803 CCGGTGAAGGGCAGGGTGGGGGG - Intergenic
1198842772 X:140876663-140876685 CTAGGGCAAGGCATGGGGGGAGG - Intergenic
1199827258 X:151512804-151512826 ATGGGGAAAAGCAGGCTGGAGGG + Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1199948228 X:152683992-152684014 CTAGTGAAAGGCACGGTGGGTGG + Intergenic
1199961451 X:152784462-152784484 CTAGTGAAAGGCACGGTGGGTGG - Intergenic
1200142982 X:153910899-153910921 GTGGGGACGGGCAGGGCGGGCGG - Intronic
1200149646 X:153944893-153944915 CTGGTGTAGGGCGGGGTGGGTGG - Intergenic
1200243331 X:154508926-154508948 CTGAGCAAAGGCAGTGTGGCAGG + Intronic
1200251597 X:154557028-154557050 CTGGGGAAAGGCGTGGATGGTGG + Intronic
1200266170 X:154647388-154647410 CTGGGGAAAGGCGTGGATGGTGG - Intergenic
1201163091 Y:11181705-11181727 CAGGGAACAGGCAGGGTGGGCGG + Intergenic
1201904495 Y:19076090-19076112 CGGGCGAAAGGCAGGGTTGCTGG - Intergenic
1201904504 Y:19076116-19076138 CGGGCGAAAGGCAGGGTTGCTGG - Intergenic
1201925051 Y:19275095-19275117 CAGGGGAAAGACATGGGGGGAGG - Intergenic