ID: 1122996549

View in Genome Browser
Species Human (GRCh38)
Location 14:105268386-105268408
Sequence CCGGGCCTTGCCAGACTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122996535_1122996549 30 Left 1122996535 14:105268333-105268355 CCACGCAGCCTCCCTGGGCTGGG 0: 1
1: 1
2: 4
3: 97
4: 814
Right 1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 161
1122996542_1122996549 5 Left 1122996542 14:105268358-105268380 CCAGGAGCAGACTCAGGCCTAGG 0: 1
1: 0
2: 3
3: 28
4: 244
Right 1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 161
1122996538_1122996549 22 Left 1122996538 14:105268341-105268363 CCTCCCTGGGCTGGGAGCCAGGA 0: 1
1: 0
2: 4
3: 80
4: 493
Right 1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 161
1122996540_1122996549 18 Left 1122996540 14:105268345-105268367 CCTGGGCTGGGAGCCAGGAGCAG 0: 1
1: 2
2: 14
3: 91
4: 745
Right 1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 161
1122996539_1122996549 19 Left 1122996539 14:105268344-105268366 CCCTGGGCTGGGAGCCAGGAGCA 0: 1
1: 0
2: 7
3: 81
4: 546
Right 1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122996549 Original CRISPR CCGGGCCTTGCCAGACTCAG TGG Intronic
901535199 1:9878139-9878161 CCTGGGCTTGCCAGACACACAGG - Intronic
902403107 1:16168588-16168610 CCGGGCATTGCCAGGCACGGTGG - Intergenic
906166429 1:43689803-43689825 TGGGGCCCTGCCAGGCTCAGCGG - Intronic
911152473 1:94608655-94608677 CCGGTCCTTTCCAGACCCATTGG - Intergenic
913178581 1:116297971-116297993 CAGGGCCATGCCAGGGTCAGTGG + Intergenic
915727551 1:158028573-158028595 CCTGGGCTTTCCAGCCTCAGTGG - Intronic
916590940 1:166189500-166189522 CAGGGCCAGCCCAGACTCAGTGG - Intergenic
918116560 1:181502984-181503006 CCTGGCCTGGCCAGGCACAGTGG - Intronic
919074509 1:192797419-192797441 CCTGGCCTTGCCAAAACCAGTGG + Intergenic
923385182 1:233459324-233459346 CCGGGCTTGGCCAGGCTCAGTGG - Intergenic
1063299907 10:4842055-4842077 CCGAGCCTGTCTAGACTCAGAGG + Intronic
1063662940 10:8046347-8046369 CCTGCCCTTGCCAGAATCACCGG - Intergenic
1064190322 10:13200362-13200384 CCGGTCCCTGCCAGCCACAGAGG + Intronic
1065686579 10:28291238-28291260 CCTGGTCTTGCCAGCATCAGTGG - Intronic
1066278108 10:33888431-33888453 CCTGGCCTTGCCAGACACGGTGG + Intergenic
1067279033 10:44857520-44857542 CCGGGCCTGGCCAGACCCAAGGG - Intergenic
1068555240 10:58451485-58451507 CCAGACCTTGCCAGTATCAGAGG - Intergenic
1072784199 10:98268948-98268970 CTGGCCCTTGTCAGACTCACGGG + Intergenic
1074596330 10:114871303-114871325 CAGAGCCTAGCCAGGCTCAGTGG - Intronic
1075461419 10:122618919-122618941 CCATGCCTGGCCAGACTCATGGG - Intronic
1076817465 10:132921931-132921953 CTGGGCTTTGCCAGACCCGGCGG + Intronic
1077162950 11:1121878-1121900 CTGGGCCTTGCCAGCATCACTGG + Intergenic
1078435084 11:11318082-11318104 CATGGCCCTGCCTGACTCAGAGG - Intronic
1079094725 11:17502897-17502919 GCAGGCCTCGCCAGACTGAGTGG + Intronic
1082071195 11:47941115-47941137 CAGGGACTTGCCAGAGGCAGGGG + Intergenic
1082932417 11:58622597-58622619 CCACGCCCTGCCTGACTCAGAGG - Intronic
1083398928 11:62410840-62410862 CAGGGCCTCGCCAGACTCTCTGG + Intronic
1084427898 11:69095551-69095573 CCGGACCCTGCCACACTCAGGGG + Intergenic
1084625918 11:70306907-70306929 CTGGGTCATGACAGACTCAGAGG + Intronic
1089334490 11:117713724-117713746 TCGGGCCTTGACAGATTCTGCGG + Intronic
1089812888 11:121146057-121146079 CCAGCACCTGCCAGACTCAGGGG + Exonic
1090069922 11:123535061-123535083 CCTGGGCTGGCTAGACTCAGTGG + Intronic
1090771925 11:129928471-129928493 CCTCGACTTCCCAGACTCAGAGG + Intronic
1091664815 12:2411566-2411588 CCTGGCCTTGCCGGAGTCACCGG + Intronic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1096611863 12:52807298-52807320 CCGGGTCTTGCCAGACCCCTGGG - Intronic
1099280670 12:80641743-80641765 CTGGGCCATTCCAGACTCAGAGG + Intronic
1102716737 12:114980320-114980342 CTGGTCTTTGCCAGACACAGTGG - Intergenic
1102858444 12:116314973-116314995 CCGGGCCAGGCCAGGCGCAGTGG + Intergenic
1102933011 12:116876762-116876784 CCAGGCCTCCCCAGCCTCAGAGG + Intronic
1104370789 12:128222212-128222234 CCTGGCATTGCCAGGCACAGTGG - Intergenic
1105516039 13:21091584-21091606 CCCTGCCTAGCCAGACTGAGAGG - Intergenic
1106181293 13:27371852-27371874 TCTGCCCTTGCCAGGCTCAGAGG - Intergenic
1110677847 13:78271184-78271206 CAGGGGCTGGCCAGACACAGGGG + Intergenic
1112409675 13:99152135-99152157 CAGGGCCTCGCCAGACTCAAGGG + Intergenic
1112571238 13:100595311-100595333 CCGGGCCTGGGCAGGCTGAGTGG + Intergenic
1113780563 13:112974342-112974364 CAGGGGCTTTGCAGACTCAGAGG - Intronic
1114452837 14:22837921-22837943 CAGGCCCTTGCCAGGCTGAGTGG - Intronic
1122474851 14:102000217-102000239 CAGGGCCCTGCCAGATTCTGGGG + Intronic
1122476961 14:102016978-102017000 CCGGGCCTTGCCTGACATGGAGG + Exonic
1122955316 14:105067708-105067730 CCAGGCCTTCCCAGACTGACTGG - Intergenic
1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG + Intronic
1123032125 14:105456875-105456897 CAATGCCTGGCCAGACTCAGAGG - Intronic
1130353035 15:83107908-83107930 CCGCGCCTGGCCAGACTAGGGGG + Intronic
1132369055 15:101280565-101280587 CCACGCCTGGCCAAACTCAGGGG - Intergenic
1132665990 16:1081566-1081588 CCCGGCCTTGTCTGGCTCAGCGG - Intergenic
1133022544 16:2973182-2973204 CCGGGCCAGGACAGCCTCAGGGG + Exonic
1135195937 16:20394728-20394750 CCAGGCCTAGCCTGACCCAGAGG + Intronic
1137597670 16:49735547-49735569 TCGGGGCTGGCCAGACTCAGTGG + Intronic
1139573895 16:67829470-67829492 CCTGGCCTGGAGAGACTCAGGGG + Exonic
1142491462 17:282391-282413 CCGGGGCTTGGCAGAGTCTGAGG + Intronic
1143526067 17:7473400-7473422 CCGGGCCTGGCCAGGCGCGGTGG - Intronic
1147670222 17:42172779-42172801 CCGGCCCTAGTCAGAGTCAGGGG + Intronic
1148205280 17:45775875-45775897 AGGGCCCCTGCCAGACTCAGTGG - Intergenic
1152623711 17:81379028-81379050 CAGGGCCTGGCCTGACTGAGTGG - Intergenic
1152666992 17:81576834-81576856 CTGGTCCTTGCCAGAGTCACGGG + Intronic
1153698521 18:7668574-7668596 CCAGGCCATGCAGGACTCAGAGG - Intronic
1155425987 18:25708187-25708209 CCGGACCTTGCCACACACTGTGG + Intergenic
1160693471 19:471004-471026 CCGGGCCTGGCCCGTCTCACAGG - Intronic
1160750194 19:730354-730376 CCCGCCCTTGCCAGACCCCGGGG + Intronic
1160869201 19:1269389-1269411 CAGGGACCTGCCCGACTCAGTGG + Intronic
1160990244 19:1857456-1857478 CCGGGCCCAGCCTGAGTCAGAGG - Intronic
1161005848 19:1936036-1936058 CTTGGCCCTGCCAGCCTCAGTGG - Intergenic
1161583259 19:5092079-5092101 CCGGGCCGGGCCAGAATGAGTGG + Intronic
1163184510 19:15628571-15628593 CAGGGTCTGGCCAGACTGAGGGG - Exonic
1163197371 19:15732577-15732599 CCTGGCCTCTCCAGACCCAGAGG + Intergenic
1163718401 19:18885903-18885925 CCGGGCATGGCAAGACTCCGTGG - Intronic
1163852076 19:19669768-19669790 CTGGGTCTTGCCAGGCGCAGTGG - Intronic
1165333905 19:35155814-35155836 CAGGCCCTGGCCAGACTCACTGG - Intronic
1165815408 19:38638986-38639008 CTGGGCCTGGCCAGGCACAGTGG + Intergenic
1166138699 19:40793636-40793658 CCTGGCCTTGCCGGGCGCAGTGG + Intronic
1167605260 19:50478599-50478621 CCTGGCCATGTCAGAATCAGGGG - Intronic
1168242808 19:55095822-55095844 CCGGGCCCTCCCAGCCTCACAGG + Intronic
927513673 2:23659783-23659805 CCAGGCCTGGCCAGCCTCTGTGG + Intronic
927864107 2:26577787-26577809 CAGGGCATTGGCAGCCTCAGGGG + Intronic
929115964 2:38444340-38444362 GCTGGCCTAGCCTGACTCAGTGG + Intergenic
929777025 2:44936064-44936086 CCGGGCCTTGATCGACCCAGAGG - Intergenic
932011679 2:67984142-67984164 CCTGGCCTGGTCAGACTCACGGG + Intergenic
935550065 2:104443315-104443337 GCGAGCCTTGGCACACTCAGAGG - Intergenic
938133070 2:128733708-128733730 CCTGGCCCTGCCATCCTCAGTGG + Intergenic
939325594 2:140683871-140683893 CTGGGCCCTGGCAGACTGAGGGG + Intronic
940219264 2:151334749-151334771 CTTGGCCTTGGCAGATTCAGGGG - Intergenic
941902394 2:170691003-170691025 GCGAGCCTTGCCAGAATCATAGG + Intergenic
943248175 2:185483238-185483260 CCAGTCCCTGCCAGGCTCAGTGG + Intergenic
947362513 2:229360705-229360727 CCTTGCCTTGTCATACTCAGTGG - Intronic
947505468 2:230705107-230705129 CCAGGCTTTGCCAGGCACAGTGG - Intergenic
947597333 2:231421332-231421354 CCGGGCCTTCTCAGAGTCTGTGG + Intergenic
948055427 2:235006678-235006700 CTTGGCCTTGCCAGTCTCATCGG - Intronic
1174113705 20:48213177-48213199 CAGGGCTGTGCCAGACTCACTGG - Intergenic
1175460832 20:59150876-59150898 GCGGGCCGTGCCAGCTTCAGAGG + Intergenic
1179887462 21:44320312-44320334 CCGGGACCTGCCAGCCACAGTGG - Intronic
1180924513 22:19544444-19544466 CCAGGCCCTGCCAGCCCCAGAGG - Intergenic
1181181245 22:21069997-21070019 CAGGTCCTTGCGAGCCTCAGAGG - Intergenic
1181855067 22:25775430-25775452 TGGGGCCTTGCCGGACCCAGTGG + Intronic
1183326244 22:37196279-37196301 CAGGACCCTGCCAGACCCAGAGG - Intronic
1184171750 22:42764256-42764278 CCGGGCCCGGCCAGCCTCACTGG + Intergenic
1184276719 22:43412934-43412956 CCGGGGCCTGCCAGACTCCTGGG - Intronic
1185401004 22:50616851-50616873 CCAGGCGTGGCCAGGCTCAGTGG + Intergenic
1185401026 22:50616995-50617017 CCAGGCGTGGCCAGGCTCAGTGG + Intergenic
949438492 3:4054964-4054986 CAGGGTCTTTCCTGACTCAGGGG + Intronic
950572818 3:13812394-13812416 CTGGGCCCAGCCAGGCTCAGAGG - Intergenic
950662721 3:14476707-14476729 CCGAGCCCTGCCAGACACATTGG - Intronic
950925960 3:16742242-16742264 CGGGGCCTTCCCAGATTCAGAGG + Intergenic
951319445 3:21226857-21226879 CAGGGCCTGACCAGATTCAGGGG - Intergenic
952908894 3:38165641-38165663 CCGGGCAGTGCCGGACTCGGAGG + Exonic
953127993 3:40110123-40110145 CAAGGCCCTGCCAGACTCATTGG + Intronic
954709904 3:52500364-52500386 ACGGGCCATGCCAGCCTCTGAGG - Intronic
956918440 3:73899777-73899799 CCTGGCCCTTCCAGACTCTGTGG + Intergenic
958071889 3:88624866-88624888 CCAGTCCTGGCCAGACACAGTGG - Intergenic
961392188 3:126558730-126558752 CAGGGCCCTGCCAGCCTCGGGGG - Exonic
961522931 3:127478189-127478211 ACGGTCCTCGCCAGCCTCAGAGG + Intergenic
961762848 3:129184127-129184149 CCGGGCCCGGCCAGACTGGGTGG + Intergenic
965418542 3:168427360-168427382 CCGGGATTTGCCAGATTCTGTGG - Intergenic
965710924 3:171555531-171555553 CTGGGCCTTGCCTGCCTCAGGGG + Intergenic
967852207 3:194090866-194090888 ACGGGGCTGGCCAGGCTCAGTGG - Intergenic
968480268 4:830165-830187 CCTGGCCTTGCCCAGCTCAGAGG - Intergenic
968615217 4:1574703-1574725 CCAGGCCTCGCCTGTCTCAGGGG - Intergenic
968750798 4:2387900-2387922 CCAGGGCTTCCCAGGCTCAGGGG - Intronic
968830614 4:2931497-2931519 CCGTGCCCTGCAGGACTCAGGGG + Intronic
968914086 4:3489591-3489613 CCAGGCCCAGCCTGACTCAGTGG - Intronic
968952317 4:3701518-3701540 CTGGGCCTTGGCAGCCACAGAGG + Intergenic
969680037 4:8637786-8637808 CATGGCCATGCCTGACTCAGGGG + Intergenic
983352061 4:166602419-166602441 CGGGGCCTTGCCAGCCACAGAGG + Intergenic
985756803 5:1724292-1724314 CAGGGCCTGGGCAGACCCAGTGG - Intergenic
985756818 5:1724339-1724361 CAGGGCCTGGGCAGACCCAGTGG - Intergenic
985756833 5:1724386-1724408 CAGGGCCTGGGCAGACCCAGTGG - Intergenic
985756848 5:1724433-1724455 CAGGGCCTGGACAGACCCAGTGG - Intergenic
985756861 5:1724480-1724502 CAGGGCCTGGACAGACCCAGTGG - Intergenic
992778928 5:80110736-80110758 CCGGGCCTGGCCAGACCCCAGGG + Intergenic
995047619 5:107669878-107669900 CCGGGCCCAGACTGACTCAGGGG + Intronic
997133563 5:131301168-131301190 CCTACCCTTGCCAGTCTCAGAGG - Intronic
1001602269 5:172936647-172936669 CAGGGCCTTGTGGGACTCAGAGG + Intronic
1002302478 5:178265241-178265263 CCTGGCCCTGCCAGACCAAGGGG - Intronic
1006791488 6:36704103-36704125 CCGGGCTTTGGCAGCCACAGTGG + Intronic
1007049771 6:38815369-38815391 CCGAGGCTTGCCCCACTCAGTGG + Intronic
1007260469 6:40559640-40559662 CTGGTCCTAGCCAGTCTCAGAGG - Intronic
1007409470 6:41653629-41653651 CTGGGCCTGGCCCCACTCAGAGG - Exonic
1009905740 6:69867778-69867800 GCGTGCCTTGTCAGCCTCAGGGG + Intronic
1012169750 6:96002828-96002850 CCGGCCCTTGCCAGGTTCTGGGG + Intergenic
1019602592 7:1892768-1892790 CAGGGCCTTCCCCGGCTCAGAGG - Intronic
1019655201 7:2189920-2189942 CCTGGCCTTGTCAGCCTTAGAGG - Intronic
1019748126 7:2712134-2712156 CCAGGCTGTGCCAGAGTCAGAGG - Intronic
1022111930 7:27237192-27237214 CCAGGCCTGGCCAGACTCTTGGG + Intergenic
1027146987 7:75702529-75702551 CCCAGCCTTGCCAGGCACAGTGG - Intronic
1029203797 7:98856260-98856282 ATGGGACTTGCCAGAGTCAGGGG + Intronic
1032096480 7:128940746-128940768 CCGGCCCTTGCCTGGCCCAGGGG - Intronic
1034151961 7:148924081-148924103 GCGGGTCTTGCCTGACTCTGAGG + Intergenic
1034693065 7:153029436-153029458 CTGGGCCTCTCCAGAGTCAGTGG + Intergenic
1035707617 8:1689266-1689288 CCGGGCATGGCCTGACTCACGGG - Intronic
1037925784 8:22843248-22843270 CAGGGCCTGGCCAGGCGCAGTGG - Intronic
1039525049 8:38207238-38207260 CCAGGCATTGCCAGGCACAGTGG - Intronic
1045269360 8:100649177-100649199 CAGTGTCTTGCCAGAGTCAGAGG + Intronic
1049257642 8:141622413-141622435 CGGGGCCCTGCCAGAGACAGAGG - Intergenic
1057656041 9:96953469-96953491 CAGGTCTTTGCCAGACACAGTGG + Intronic
1060694520 9:125696216-125696238 CCAGGCCTGGCCAGATGCAGTGG + Intronic
1060751751 9:126174151-126174173 TCAGGCCTTGCCAGTCTCAATGG + Intergenic
1061786378 9:133030988-133031010 GCGGGCCCTGCCAGACGCACAGG + Exonic
1062206330 9:135339541-135339563 CCTGGCCTTCCCAGCCTCTGTGG - Intergenic
1062321210 9:135991235-135991257 CCAGACCCTGCCAGACTCACGGG - Intergenic
1186650058 X:11549685-11549707 CAGGGCCTTTCCAGACAAAGTGG - Intronic
1193175185 X:78384345-78384367 CTGGGCCTTCCCTGACCCAGCGG + Intergenic
1197720969 X:129744433-129744455 CCAGGCCTTCCCATACTCTGTGG + Intronic
1201256023 Y:12109020-12109042 CCATGCCCTGCCAGACTCACAGG - Intergenic