ID: 1123000783

View in Genome Browser
Species Human (GRCh38)
Location 14:105293034-105293056
Sequence TTCACCCGTTTCCTAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123000780_1123000783 4 Left 1123000780 14:105293007-105293029 CCTCACCCAGATGGCAACGGGAC 0: 1
1: 0
2: 1
3: 11
4: 85
Right 1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1123000776_1123000783 8 Left 1123000776 14:105293003-105293025 CCTCCCTCACCCAGATGGCAACG 0: 1
1: 0
2: 1
3: 12
4: 191
Right 1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1123000779_1123000783 5 Left 1123000779 14:105293006-105293028 CCCTCACCCAGATGGCAACGGGA 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1123000781_1123000783 -1 Left 1123000781 14:105293012-105293034 CCCAGATGGCAACGGGACAGAAT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1123000774_1123000783 18 Left 1123000774 14:105292993-105293015 CCAGCAGCTTCCTCCCTCACCCA 0: 1
1: 0
2: 10
3: 77
4: 679
Right 1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 73
1123000782_1123000783 -2 Left 1123000782 14:105293013-105293035 CCAGATGGCAACGGGACAGAATT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123000783 Original CRISPR TTCACCCGTTTCCTAAGAGC AGG Intronic
901814356 1:11785365-11785387 TTCACCTGTTTCCAAGGGGCTGG - Intronic
905992375 1:42349446-42349468 TTCTCCCGTCTCCTAAATGCAGG + Intergenic
906016022 1:42580364-42580386 GTCACCCGTTTTCTAAGAGAGGG - Intronic
909712905 1:78672876-78672898 TTCTCCCTTTCCCTAGGAGCAGG + Intergenic
909938744 1:81586256-81586278 TTCACCCATTTCCAAACAGAAGG + Intronic
910241563 1:85092209-85092231 TAGACCCCTTTCCTAAGACCTGG - Intronic
915307344 1:154988240-154988262 TTCACCCATGTCCTCACAGCAGG + Exonic
915518624 1:156428624-156428646 TTCCCCCCTTTCCTATGAGCTGG - Intronic
917046983 1:170871993-170872015 GTGCCCAGTTTCCTAAGAGCAGG + Intergenic
1066331940 10:34432999-34433021 TTCAGCCATTTACTAACAGCAGG + Intronic
1067111977 10:43407583-43407605 TCCACAAGTTTCCTACGAGCAGG + Intronic
1070018315 10:72557332-72557354 TTTCCCCTTTTCCTGAGAGCTGG - Intronic
1070706839 10:78645928-78645950 TCCCCCTGTTCCCTAAGAGCTGG + Intergenic
1086966534 11:93033593-93033615 TTTACCCTTTTCCTCAGACCTGG + Intergenic
1088113794 11:106293804-106293826 TTCACTAGTTTCCTAAGAAATGG + Intergenic
1094117921 12:26937959-26937981 TTCCCAGGCTTCCTAAGAGCAGG + Exonic
1102464434 12:113120223-113120245 TTCTTCGGTTTCCTAGGAGCTGG + Intronic
1104013418 12:124947679-124947701 TTGACCCACTTCCTGAGAGCAGG + Exonic
1105773682 13:23636893-23636915 TTCACCCCTTTCTCAAGAGTTGG + Intronic
1107893137 13:44931559-44931581 TATATGCGTTTCCTAAGAGCAGG - Intergenic
1112595690 13:100804922-100804944 TTCTCCCAGTTCCCAAGAGCTGG - Intergenic
1118696637 14:68392662-68392684 TTCACCAATTACCTAAGAGCTGG + Intronic
1122070205 14:99201075-99201097 TCCAGCATTTTCCTAAGAGCAGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1123000783 14:105293034-105293056 TTCACCCGTTTCCTAAGAGCAGG + Intronic
1125343237 15:38695032-38695054 TTCACCCGTTTCCCAAAACTTGG + Intergenic
1125976416 15:43956598-43956620 TTAACCCGTGACCCAAGAGCAGG - Intronic
1135389348 16:22076549-22076571 TTCTCCTGTTTCTTTAGAGCAGG - Intronic
1140406926 16:74717396-74717418 TTCCTCCTTTTCCTGAGAGCTGG - Intronic
1147661316 17:42118498-42118520 GTCCCCAGTTCCCTAAGAGCAGG - Intronic
1151260051 17:72909050-72909072 GAGAACCGTTTCCTAAGAGCAGG + Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1153051089 18:904148-904170 TTCACCCGTTTCTCAAGGACAGG - Intergenic
1158709126 18:59821458-59821480 TTCCCCATTTCCCTAAGAGCTGG - Intergenic
1158903743 18:61990514-61990536 TGAACCCGCTACCTAAGAGCTGG - Intergenic
1159281099 18:66287198-66287220 TTCACACTCTTCCTAAGACCTGG - Intergenic
1160777987 19:865319-865341 TTTACCAAATTCCTAAGAGCAGG - Intergenic
1162054730 19:8055855-8055877 GTCACCCTTTTCCCCAGAGCAGG + Intronic
925435146 2:3830537-3830559 TTCACAAATTTCCCAAGAGCTGG - Intronic
927392326 2:22609397-22609419 TTCCCCTGTTTCCACAGAGCGGG - Intergenic
927560921 2:24072643-24072665 TTCTCCAGTTTCGTAAGAGTAGG + Intronic
930623651 2:53670966-53670988 TTCATCCATTTCTTAAGTGCAGG - Intronic
936059229 2:109283580-109283602 TTCAGCCCCTTCCTAAAAGCTGG + Intronic
939703026 2:145418110-145418132 TTCACCCTTGTCATAAGGGCAGG + Intergenic
940492310 2:154378409-154378431 CTCAAGCGTTTCCTAATAGCAGG - Intronic
941752360 2:169146633-169146655 ATAAGCCATTTCCTAAGAGCAGG + Intronic
1176026370 20:62987627-62987649 TTCACCCGTGTCCTCAGGGTGGG - Intergenic
1180914798 22:19478791-19478813 TTCACGGGTTTCCCAAGTGCTGG - Intronic
954333304 3:49902231-49902253 CTCACCCAGTTCCTAAGTGCTGG - Intronic
962542583 3:136397634-136397656 TTCACCCCTGTGGTAAGAGCAGG + Intronic
967283389 3:187844285-187844307 TTCAATCATTTTCTAAGAGCAGG - Intergenic
973903981 4:55507884-55507906 ATTACCAGTTTCCTAAGAGTGGG - Intronic
987590168 5:19914793-19914815 GTCAATAGTTTCCTAAGAGCTGG + Intronic
992546847 5:77821694-77821716 TTCACAGGCTTTCTAAGAGCAGG - Intronic
993802009 5:92353529-92353551 TTCACCAGTTTCCGAAGTGTTGG + Intergenic
997434026 5:133861267-133861289 TTGATCCGTTTCCTAACAGTAGG + Intergenic
997439186 5:133897293-133897315 TTAAGCCCTTTCCTAAGTGCAGG - Intergenic
999671775 5:153964856-153964878 TTCACCCGTTTTCTCAGAAGAGG - Intergenic
1003909562 6:10730990-10731012 TTCACACTGTTCCTCAGAGCAGG - Exonic
1004544393 6:16583444-16583466 AGCATGCGTTTCCTAAGAGCTGG + Intronic
1008056026 6:46946785-46946807 CACAGCCGTTTCCTGAGAGCAGG + Intronic
1009283654 6:61783691-61783713 TTCACCTTTTTCTTAAGAGATGG - Intronic
1009835115 6:68990469-68990491 GGCACCTGTTTGCTAAGAGCTGG + Intronic
1010405393 6:75499796-75499818 TTCATCTCTTTCCAAAGAGCTGG + Intergenic
1026352081 7:69526308-69526330 TTCACCTGTACCCTAAAAGCAGG + Intergenic
1027004882 7:74684650-74684672 TGCACCCATTTCCAGAGAGCAGG + Intronic
1027024396 7:74840491-74840513 TGCACCCATTTCCAGAGAGCAGG - Intronic
1027063369 7:75103631-75103653 TGCACCCATTTCCAGAGAGCAGG + Intronic
1032622137 7:133546226-133546248 TTCACCCTTTTTATAATAGCTGG + Intronic
1039158047 8:34584933-34584955 TTCACCCTTTTCCTAGGTGAAGG + Intergenic
1039742961 8:40398686-40398708 TCCACGGGTTTCCTGAGAGCTGG + Intergenic
1041132447 8:54715848-54715870 ATCACAAGTTTCCTGAGAGCAGG - Intergenic
1047629398 8:126690728-126690750 CTCTCACGTTTCCTGAGAGCTGG - Intergenic
1056033990 9:82584499-82584521 TTCACGTCTTTCCTAACAGCCGG + Intergenic
1192564035 X:72147782-72147804 TTTATCCCTTTCCTGAGAGCAGG - Intergenic
1193216449 X:78870024-78870046 TGCTCCTTTTTCCTAAGAGCAGG + Intergenic
1195717398 X:107829928-107829950 TTAATCCCTTCCCTAAGAGCAGG + Intronic
1197685393 X:129434370-129434392 TTCACCTGTTTCCTGACATCTGG + Intergenic