ID: 1123000866

View in Genome Browser
Species Human (GRCh38)
Location 14:105293421-105293443
Sequence CAGTGTCACCAGAACTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 153}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123000866_1123000873 10 Left 1123000866 14:105293421-105293443 CCCCACAAGTTCTGGTGACACTG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1123000873 14:105293454-105293476 CTCCTTGCACAGGACGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 151
1123000866_1123000870 0 Left 1123000866 14:105293421-105293443 CCCCACAAGTTCTGGTGACACTG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1123000870 14:105293444-105293466 AGGTGTGCTGCTCCTTGCACAGG 0: 1
1: 0
2: 2
3: 15
4: 147
1123000866_1123000875 25 Left 1123000866 14:105293421-105293443 CCCCACAAGTTCTGGTGACACTG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1123000875 14:105293469-105293491 GAGGAGGGACCCCTGCAAGCAGG 0: 1
1: 0
2: 3
3: 41
4: 234
1123000866_1123000872 9 Left 1123000866 14:105293421-105293443 CCCCACAAGTTCTGGTGACACTG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1123000872 14:105293453-105293475 GCTCCTTGCACAGGACGAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 134
1123000866_1123000871 6 Left 1123000866 14:105293421-105293443 CCCCACAAGTTCTGGTGACACTG 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1123000871 14:105293450-105293472 GCTGCTCCTTGCACAGGACGAGG 0: 1
1: 0
2: 1
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123000866 Original CRISPR CAGTGTCACCAGAACTTGTG GGG (reversed) Intronic
902714992 1:18266593-18266615 CAGTGGCCCAAGAACTTATGTGG + Intronic
903179579 1:21598412-21598434 CAGTGTCAGCACCACTAGTGGGG - Exonic
905911757 1:41659862-41659884 CCGTGTCCCCAGAGCTGGTGAGG - Intronic
906537167 1:46557664-46557686 CTGTGTCCCCAGGTCTTGTGTGG - Exonic
907332531 1:53680398-53680420 CAGTGGCACCAGTACTGGGGTGG + Intronic
909259403 1:73468051-73468073 TAGTTTCAACAGAACTTGTCAGG + Intergenic
909939228 1:81591232-81591254 CATTGTCCCCTGAACATGTGTGG - Intronic
916363434 1:163997138-163997160 AGTTGTCACCAGTACTTGTGAGG - Intergenic
916642134 1:166741539-166741561 CAAGGTGACCAGGACTTGTGAGG + Intergenic
916823618 1:168423986-168424008 CAGTGTCACCATAACCTCTTTGG - Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
919027363 1:192193279-192193301 CAGTGTCACCAGCCATTGTAAGG + Intergenic
923039409 1:230309035-230309057 CAGAGTCACCAGAAGCGGTGCGG + Intergenic
1065651305 10:27894820-27894842 CTGTGACCCCAGAACTTGAGAGG - Intronic
1067269825 10:44780802-44780824 CAGTATCCCTAGAATTTGTGTGG - Intergenic
1069249093 10:66245810-66245832 CAGTATGACCAGAACCTGAGAGG - Intronic
1072205064 10:93196314-93196336 GAGTGTCAGGAGAACTTGGGAGG + Intergenic
1074655990 10:115587784-115587806 TAGTGTCAAAAGAACTTGTTGGG - Intronic
1081162166 11:39762572-39762594 CAATGTGAACTGAACTTGTGGGG + Intergenic
1081588346 11:44403028-44403050 CAGTCTAACCAGATCTTTTGGGG + Intergenic
1087909663 11:103738621-103738643 CAGTTTCACTTGAACTTGAGTGG + Intergenic
1088323301 11:108575574-108575596 CAGGGTCAACATAACTTTTGTGG - Intronic
1091322860 11:134664277-134664299 CAGTGTGAGCAGAATGTGTGTGG - Intergenic
1091469391 12:713732-713754 CATTTTCACAAGAATTTGTGTGG - Intergenic
1092561315 12:9616760-9616782 CAGAGTCACTTGAACCTGTGAGG + Intergenic
1094498838 12:31005916-31005938 CTGTGACACCCCAACTTGTGGGG - Intergenic
1095214849 12:39536321-39536343 CAGTGCCACCAGAGTTTCTGTGG - Intergenic
1095380643 12:41586871-41586893 CAGAGTAACCAGAATTTTTGTGG + Intergenic
1097277228 12:57821773-57821795 CAGAGTCCCCAGAACTCATGTGG - Exonic
1097702243 12:62831983-62832005 CAGTGTCCCCAGAGTTAGTGGGG - Intronic
1098676539 12:73295930-73295952 CAGTTTCACCTGAACTTTTGTGG + Intergenic
1100780038 12:98014241-98014263 CTTTGTCTCCAGAACTTGTTTGG - Intergenic
1101099188 12:101374763-101374785 CAATGTCAAGAGAACTTGGGAGG - Intronic
1101414832 12:104499845-104499867 AAATGTCCCCAGAACCTGTGGGG - Intronic
1102200924 12:111057223-111057245 AAGTGTGACAAGAAATTGTGTGG + Intronic
1102879671 12:116474592-116474614 CAGTCTCACCAGAAACTCTGTGG - Intergenic
1104210277 12:126682278-126682300 CAGTGGCACTGGAACTTTTGGGG + Intergenic
1106322229 13:28652149-28652171 CAGGGCTGCCAGAACTTGTGTGG - Intergenic
1108049544 13:46418893-46418915 AAGTGTCACTAAAATTTGTGTGG + Intronic
1108172450 13:47755776-47755798 CTGGGTCACCAGAACTAGAGTGG + Intergenic
1108584742 13:51860887-51860909 CTGTGTCTCCAGAATTTGTTTGG - Intergenic
1109542065 13:63792176-63792198 AAGTGTCACTAAAATTTGTGTGG + Intergenic
1117306692 14:54484047-54484069 CAATGTCATCAGAACTGGAGAGG + Intronic
1123000866 14:105293421-105293443 CAGTGTCACCAGAACTTGTGGGG - Intronic
1125511157 15:40293127-40293149 GAGTGTCACCAGATTTGGTGAGG + Intronic
1126908437 15:53392564-53392586 CAGTGTCCCCTAAACTTGAGAGG - Intergenic
1131391440 15:92052136-92052158 GAGTGTGCACAGAACTTGTGTGG + Intronic
1131629875 15:94165424-94165446 CAATGAAACCAGAACTTCTGTGG + Intergenic
1134612454 16:15620073-15620095 GAGAATCACCTGAACTTGTGAGG + Intronic
1139552921 16:67685650-67685672 CAGTGGGACCAGAACTCGGGCGG + Exonic
1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG + Intronic
1145747502 17:27331392-27331414 CTGTCTCACCCCAACTTGTGAGG - Intergenic
1149652027 17:58281557-58281579 CAGTGTAACCAGAATTTCAGAGG - Intergenic
1151551215 17:74823575-74823597 CAGTCTCCCCAGAACTTATTTGG - Intronic
1153062649 18:1010020-1010042 CAGTCTCACCAATACTTTTGTGG + Intergenic
1153948041 18:10033938-10033960 CAGAGCCACCAGAACGTATGTGG + Intergenic
1157967704 18:52226983-52227005 CAGTGTCATCAGATCTTTTCTGG - Intergenic
1159546256 18:69842559-69842581 CTGTGTAACCAGAACTTGCAGGG + Exonic
1159880649 18:73855562-73855584 AAGTGGCAGCAGTACTTGTGGGG - Intergenic
1161904646 19:7147553-7147575 CAGCGTCATCAGAAAATGTGTGG + Intronic
1162090919 19:8279502-8279524 CAGTGTATCCAGAATTGGTGGGG + Intronic
1162093152 19:8294340-8294362 CAGTGTATCCAGAATTGGTGGGG + Intronic
1164957978 19:32403529-32403551 CACTGTCACCATCACTTGGGAGG - Intergenic
925659592 2:6188164-6188186 CAGGGACACCAGAGCATGTGGGG + Intergenic
925920428 2:8634197-8634219 CAGGGTCACCAGAGCTTCTCAGG + Intergenic
926438278 2:12859831-12859853 CACTGTCACCTGAAGTTATGTGG + Intergenic
926526520 2:13987926-13987948 CAGTGTGAACAGAACTTCAGAGG - Intergenic
926829936 2:16950676-16950698 CACTGTTATCAGATCTTGTGGGG - Intergenic
927338534 2:21953272-21953294 CAGTGTCACCACAACTTCAAGGG - Intergenic
929476420 2:42254573-42254595 CAGTGAAACCAAAACTTATGAGG + Intronic
931155339 2:59622237-59622259 CATTGTTACAAGAACTTGTCTGG - Intergenic
933351586 2:81159400-81159422 CAACATCACCAGAACTTGTTAGG + Intergenic
934135500 2:88992621-88992643 CAGAGTCACCATCACTTGTCGGG - Intergenic
934140295 2:89040436-89040458 CAGAGTCACCATCACTTGTCGGG - Intergenic
934146521 2:89100071-89100093 CAGAGTCACCATCACTTGTCGGG - Intergenic
934165075 2:89286908-89286930 CAGTGTCACCATCACTTGCCGGG - Intergenic
934221031 2:90083057-90083079 CAGAGTCACCATCACTTGTCGGG + Intergenic
934222747 2:90100504-90100526 CAGAGTCACCATCACTTGTCGGG + Intergenic
934228940 2:90160101-90160123 CAGAGTCACCATCACTTGTCGGG + Intergenic
934818926 2:97355109-97355131 CAGTGTCACCATCACTTGCCGGG + Intergenic
935327248 2:101948251-101948273 CACTATCACGAGAACATGTGGGG + Intergenic
935614202 2:105059827-105059849 CATTGGCCCCAGAACGTGTGTGG - Intronic
936706843 2:115085612-115085634 CAGTGCCACTAGAACATGTTAGG + Intronic
938077875 2:128350065-128350087 CAAAGTCACCAGGACTTCTGGGG + Intergenic
940650084 2:156433711-156433733 CAGTGTGACTAGGACTAGTGGGG + Intergenic
940870852 2:158859208-158859230 CAGTGTCCACAGAAGTTTTGGGG - Intronic
940985728 2:160050250-160050272 CAGTGTCACCAGACTCTGAGCGG + Intronic
942459210 2:176158092-176158114 CAGAGGCAGCAGAACTTGGGTGG - Intronic
943081207 2:183260962-183260984 CCGTGTCACCGGACCTGGTGGGG + Intergenic
944373786 2:199015799-199015821 CAGTGTTACCATAAATTCTGTGG + Intergenic
947077973 2:226364919-226364941 CAGTTCCACTAGACCTTGTGAGG - Intergenic
947821301 2:233072964-233072986 CTGTGTCACCAGAACCTGGCAGG + Intronic
1170000499 20:11608719-11608741 CTGTGTCACCGGACCTGGTGGGG - Intergenic
1170918936 20:20657270-20657292 CAGTGTGACCAGAAATGGCGAGG + Intronic
1171418400 20:24999491-24999513 CAGTGATACCAGAATTTCTGGGG - Intergenic
1174610875 20:51797867-51797889 CAGTGTCTCCAGAATTTGATTGG - Intronic
1174979067 20:55371677-55371699 CATCCTCACCAGTACTTGTGTGG + Intergenic
1178863368 21:36307681-36307703 CAGTCTCCCCAAAAGTTGTGAGG - Intergenic
1179127938 21:38608732-38608754 CAGGGGCACCAGAACCAGTGGGG + Intronic
1181275368 22:21684681-21684703 CTGTGTCCCCAGCACGTGTGTGG + Intronic
1181597261 22:23924216-23924238 CAGTGTGGCCAGAAGTTTTGTGG - Intergenic
1184230229 22:43154811-43154833 CAGGGTCTCCAGGTCTTGTGAGG - Intronic
950409337 3:12824959-12824981 CAGAGTCACCAGCACTTCTCAGG - Intronic
950612921 3:14137531-14137553 CAGAGACCCCAGACCTTGTGTGG - Intronic
950941113 3:16892762-16892784 AAGTCTCACCAGAACCTGTAAGG + Intronic
952484656 3:33798342-33798364 CAGTGACACCAGTACTTCTCCGG + Intronic
953839178 3:46374950-46374972 CAGAGTCAGCAGAACTGGGGTGG + Exonic
955136455 3:56223579-56223601 AAGTGTCAGCAGAAATAGTGTGG - Intronic
960903086 3:122571634-122571656 TAGTGTCACCACAAATTGTTCGG - Intronic
969012707 4:4079899-4079921 CAGTGTGACTAGAACTTGCCAGG - Intergenic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
969523795 4:7693910-7693932 GAGTGTCCACAGAACTGGTGGGG - Intronic
971542924 4:27843891-27843913 CTGTGTGTCCAGAATTTGTGAGG - Intergenic
972762659 4:42122075-42122097 CTGTGTCACCAGTACTTTTGCGG + Intronic
972957162 4:44407212-44407234 CAGTGTCTTCAGAACTTGGTTGG - Intronic
976754700 4:88485406-88485428 CAGTCTCACCAGACTTTGGGTGG + Intronic
983260846 4:165454598-165454620 TAATGTCATCAGAACCTGTGTGG - Intronic
985695056 5:1335464-1335486 CCGGGGCACCAGGACTTGTGCGG - Intronic
988934864 5:36071706-36071728 CAGGGTTGCCAGAACTGGTGGGG + Intergenic
988967303 5:36432298-36432320 CACTGTCATCAGAACTTTGGTGG - Intergenic
990661433 5:58019915-58019937 TTGTGTCACAAGCACTTGTGGGG + Intergenic
992654413 5:78894113-78894135 CAGACTCTCCAGCACTTGTGTGG - Intronic
996420700 5:123258904-123258926 CAGTGTAAACAAAACTTCTGGGG - Intergenic
998082140 5:139285047-139285069 CAGTCACACGAGAACTTGTGTGG + Intronic
998509295 5:142697989-142698011 CAGTGTCAGCTGCACTTGTAGGG - Exonic
999519037 5:152331521-152331543 CAGTGTCAAAAGGACTTGGGTGG - Intergenic
1002942936 6:1733728-1733750 CATTGTCCCAAGTACTTGTGAGG + Intronic
1005650273 6:27879247-27879269 CAGAGTCCCCAGAACTCGTGTGG - Intergenic
1005762796 6:28983059-28983081 CAGGGTCACCAAACCTTGTCAGG - Intergenic
1007616619 6:43183507-43183529 CAGTGGGATCAGAACATGTGAGG - Intronic
1008228032 6:48946251-48946273 CAGTGTGCCTAGAATTTGTGGGG + Intergenic
1010084265 6:71897998-71898020 CAGGTTGACCAGAACTTATGAGG + Intronic
1013827943 6:114237548-114237570 CAGTGGAACCAGAATCTGTGAGG - Intronic
1013855158 6:114563649-114563671 CAGTCTAACCAATACTTGTGTGG - Intergenic
1015310159 6:131757959-131757981 TAGTGTCATCAGAAGTTCTGAGG - Intergenic
1022773063 7:33495193-33495215 CAGTGTCACCAGCATTGTTGGGG + Intronic
1022823236 7:33981910-33981932 TCCTGCCACCAGAACTTGTGGGG - Intronic
1023085203 7:36563282-36563304 CAGTGACAGCAGAAATAGTGGGG - Intronic
1026122400 7:67549397-67549419 CAGAGTCACCAAAATTTGAGCGG - Intergenic
1029026346 7:97420910-97420932 CAGTTTCTACAGAGCTTGTGGGG - Intergenic
1029134526 7:98359683-98359705 CAGTGTCACAAGAATTTGAGTGG - Intronic
1029710653 7:102297543-102297565 CAGTGACTCCAGGACTTGAGGGG - Intronic
1034200598 7:149281129-149281151 TAATGTCACCAGAACTCTTGGGG + Intronic
1035173602 7:157034355-157034377 CAGTGTCACCTACACCTGTGAGG - Intergenic
1039403611 8:37294135-37294157 CAATGTGACCAGACCTTGGGAGG - Intergenic
1039457290 8:37715933-37715955 CAGTGTCACCCCAACATGTTTGG + Intergenic
1042998054 8:74722758-74722780 AATTTTCACCAGAACTTTTGTGG + Intronic
1044881990 8:96732696-96732718 CAATGTGGCCAGAAATTGTGTGG - Intronic
1048513174 8:135080621-135080643 CAGTGTCAGCAGAAGGGGTGGGG - Intergenic
1051797262 9:20886543-20886565 CAGTGGCATCAGAAGTTATGAGG + Intronic
1056810221 9:89758061-89758083 CAGTGTCACCAGCAAGGGTGTGG - Intergenic
1057192339 9:93095117-93095139 CAGTGTGACCCGAACTAGAGAGG - Intergenic
1059744594 9:117187910-117187932 CAGTTTCACAAGAACGTGGGAGG - Intronic
1060886826 9:127160484-127160506 CAGTGTCACCAGGCCCTGTGTGG + Intronic
1061134184 9:128723923-128723945 CAGTGTGACCAGAACGTCTGGGG + Intronic
1061601234 9:131671515-131671537 CAGTGCCCCCAGAACCTCTGTGG - Intronic
1188054078 X:25521672-25521694 CAGTTTCATCAGAATTTGTGGGG - Intergenic
1188913960 X:35887410-35887432 CAGTGTCAGCAGAGATTGAGTGG - Intergenic
1190189308 X:48263178-48263200 CAGTGTAACCAGAATTGGTATGG + Intronic
1190961304 X:55251618-55251640 GAGAATCACCTGAACTTGTGAGG - Intronic
1191047232 X:56151583-56151605 CAGTGTTCCCAGTATTTGTGTGG - Intergenic
1192393250 X:70753177-70753199 CAGAGTCACCGGAATTTGGGTGG + Intronic
1194657892 X:96595761-96595783 CAGTGCAACTAGAATTTGTGAGG - Intergenic
1196817637 X:119677761-119677783 CGGTGTCACTAGATCCTGTGAGG + Intronic