ID: 1123000945

View in Genome Browser
Species Human (GRCh38)
Location 14:105293767-105293789
Sequence TTGGAAGCCAGGCCCCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123000945_1123000954 -5 Left 1123000945 14:105293767-105293789 CCCCCGTGGGGCCTGGCTTCCAA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1123000954 14:105293785-105293807 TCCAAGGTCAGGACCCTCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 165
1123000945_1123000956 7 Left 1123000945 14:105293767-105293789 CCCCCGTGGGGCCTGGCTTCCAA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1123000956 14:105293797-105293819 ACCCTCTGGGGACTCTCCTGAGG 0: 1
1: 0
2: 2
3: 126
4: 9229
1123000945_1123000952 -7 Left 1123000945 14:105293767-105293789 CCCCCGTGGGGCCTGGCTTCCAA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1123000952 14:105293783-105293805 CTTCCAAGGTCAGGACCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 166
1123000945_1123000959 14 Left 1123000945 14:105293767-105293789 CCCCCGTGGGGCCTGGCTTCCAA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1123000959 14:105293804-105293826 GGGGACTCTCCTGAGGCCTCTGG 0: 1
1: 0
2: 2
3: 30
4: 330
1123000945_1123000953 -6 Left 1123000945 14:105293767-105293789 CCCCCGTGGGGCCTGGCTTCCAA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1123000953 14:105293784-105293806 TTCCAAGGTCAGGACCCTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123000945 Original CRISPR TTGGAAGCCAGGCCCCACGG GGG (reversed) Intronic