ID: 1123001047

View in Genome Browser
Species Human (GRCh38)
Location 14:105294238-105294260
Sequence GGCCCAGCAACCAACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123001047_1123001052 6 Left 1123001047 14:105294238-105294260 CCACCACAGTTGGTTGCTGGGCC 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1123001052 14:105294267-105294289 TCCCTCCAGAGAGTGTGCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 211
1123001047_1123001051 5 Left 1123001047 14:105294238-105294260 CCACCACAGTTGGTTGCTGGGCC 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1123001051 14:105294266-105294288 CTCCCTCCAGAGAGTGTGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 207
1123001047_1123001056 14 Left 1123001047 14:105294238-105294260 CCACCACAGTTGGTTGCTGGGCC 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1123001056 14:105294275-105294297 GAGAGTGTGCCTGGGCTCAGAGG 0: 1
1: 0
2: 4
3: 66
4: 537
1123001047_1123001059 23 Left 1123001047 14:105294238-105294260 CCACCACAGTTGGTTGCTGGGCC 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1123001059 14:105294284-105294306 CCTGGGCTCAGAGGCGTCTTGGG 0: 1
1: 0
2: 1
3: 11
4: 257
1123001047_1123001057 22 Left 1123001047 14:105294238-105294260 CCACCACAGTTGGTTGCTGGGCC 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1123001057 14:105294283-105294305 GCCTGGGCTCAGAGGCGTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 224
1123001047_1123001060 24 Left 1123001047 14:105294238-105294260 CCACCACAGTTGGTTGCTGGGCC 0: 1
1: 0
2: 0
3: 3
4: 120
Right 1123001060 14:105294285-105294307 CTGGGCTCAGAGGCGTCTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123001047 Original CRISPR GGCCCAGCAACCAACTGTGG TGG (reversed) Intronic
900358159 1:2274683-2274705 GTCCCATCAACCAACTGTCATGG - Intronic
901743318 1:11356354-11356376 GGCCCCTCAGTCAACTGTGGTGG + Intergenic
906298249 1:44662320-44662342 GGCCGAGCCAGCACCTGTGGAGG - Intronic
906686110 1:47764487-47764509 GGCACAGCAGCCAAGTGGGGAGG - Exonic
908658670 1:66415229-66415251 GGCCCAGCCGAGAACTGTGGAGG + Intergenic
913373567 1:118127557-118127579 GGCCCTGCCTCCAACAGTGGGGG + Intronic
917798702 1:178551389-178551411 GGCCTTGGAACTAACTGTGGTGG + Intergenic
918317325 1:183332852-183332874 GGCCCAGAAACCAGCAGGGGAGG - Intronic
919657754 1:200214136-200214158 GGCCCAGCACATAGCTGTGGTGG + Intergenic
921286393 1:213613473-213613495 GGCCCAGAAAGGGACTGTGGTGG + Intergenic
923547543 1:234933757-234933779 GATCCAGAAACCAAGTGTGGTGG + Intergenic
1063441610 10:6077674-6077696 GGCCCAGCCACCATCTTTGCTGG + Intergenic
1074187342 10:111108313-111108335 GGCCCAACAGCCCACAGTGGGGG - Intergenic
1075220542 10:120580889-120580911 TACACAGCAGCCAACTGTGGAGG - Intronic
1077466095 11:2734435-2734457 GGCCCCGCAGCCAGCTGTGCTGG + Intronic
1078083424 11:8219742-8219764 TGCCCAGGAACCGCCTGTGGTGG + Intergenic
1079338255 11:19590022-19590044 GGCTCAGGAACCAGCTGTGTGGG + Intronic
1080204465 11:29712937-29712959 GGCTCAGGAGCCCACTGTGGGGG - Intergenic
1083184220 11:61008124-61008146 GGACTAGGAACCAAGTGTGGGGG - Intronic
1083924142 11:65795783-65795805 ACCCCTGCAAACAACTGTGGTGG + Exonic
1088973191 11:114791418-114791440 GGGCCAGGAGACAACTGTGGTGG - Intergenic
1090165120 11:124538305-124538327 CTTCCAGCAACCAGCTGTGGTGG + Intergenic
1093441907 12:19208512-19208534 GGCCCAGCCACCTACTTTAGGGG + Intronic
1094319814 12:29172074-29172096 TGCCCAGCCACCAACTGTCTGGG + Intronic
1096696797 12:53354381-53354403 GGCCCAGCTTCCCACAGTGGAGG + Intergenic
1096777058 12:53970746-53970768 GGCCCAGGAATAAACTTTGGTGG + Intergenic
1099246747 12:80201538-80201560 GGCCCTGCATCCAACATTGGAGG + Intergenic
1099504311 12:83453841-83453863 GGCCCAGCAGCAATCTATGGAGG - Intergenic
1102023910 12:109702399-109702421 GGCCCAGCAAGGAACTGCAGAGG + Intergenic
1103564462 12:121808479-121808501 GGCCCTGCTCCCAATTGTGGGGG - Intronic
1119555089 14:75546873-75546895 GGGCCTGCAACCCACAGTGGTGG - Exonic
1120608223 14:86605891-86605913 GGCTCAGAAACCTGCTGTGGGGG - Intergenic
1123001047 14:105294238-105294260 GGCCCAGCAACCAACTGTGGTGG - Intronic
1124061548 15:26298142-26298164 TGCGCAGCAGCCCACTGTGGAGG + Intergenic
1126108209 15:45160897-45160919 GTCCCAGCAATCATCTATGGGGG + Exonic
1126526856 15:49665901-49665923 GGCCCAGAAACCAGCTGAAGAGG + Intergenic
1127820037 15:62646764-62646786 GGCCCAGAATCCAAGGGTGGTGG + Intronic
1128330249 15:66750960-66750982 GGCCCAGCAAACACCTCTGCCGG - Intronic
1131380757 15:91962083-91962105 GGCCCAAGAACAAACTCTGGCGG + Intronic
1132797721 16:1733558-1733580 GGCCCAGGAACCTGCTGTCGAGG + Intronic
1139261507 16:65598867-65598889 TGCCCTGCAACCCACAGTGGGGG - Intergenic
1139962830 16:70727826-70727848 GGCCCAGCCACCCAGTCTGGGGG - Intronic
1140624047 16:76770543-76770565 AGCCCTGCAACCAGGTGTGGTGG - Intergenic
1140778816 16:78275342-78275364 GCCCCATCATCCAACTGGGGCGG - Intronic
1141178948 16:81739316-81739338 GGCCCAGAGAGCAACAGTGGCGG + Intronic
1145762100 17:27430899-27430921 GGCCCATCCAGCAAGTGTGGTGG - Intergenic
1151232687 17:72696021-72696043 CGCCCAGCATCCAGGTGTGGTGG - Intronic
1152278439 17:79371625-79371647 GTCCCACCAACCAAATGTGGTGG + Intronic
1152632853 17:81418304-81418326 GGCCCAGCTCCCCTCTGTGGTGG - Intronic
1153959047 18:10124650-10124672 CGCCCAGCAAGCCACTGGGGAGG + Intergenic
1155640771 18:28011457-28011479 GGCCCAAAAACCATCTGTAGAGG + Intronic
1156228636 18:35132918-35132940 GGCCCAGCAGCCAGAGGTGGAGG + Intronic
1159054997 18:63454591-63454613 GTCCCAGCAACAAACTTAGGAGG + Intergenic
1160925287 19:1541701-1541723 GGCCCAGACACCAAATGTGAAGG + Intergenic
1161272565 19:3398016-3398038 TGCCCAGCAACCCACAGGGGTGG - Intronic
1164234728 19:23322369-23322391 GGCCCAGCACCTAACTGTTGTGG + Intronic
1164302509 19:23974177-23974199 GGCCCAGCACCTAAGTGTTGTGG - Intergenic
1165770375 19:38376464-38376486 GGCCCTGCCCCCAACTGGGGGGG + Intronic
1168023444 19:53626440-53626462 GTCCCAGCTACCTACTGAGGAGG + Intergenic
925885855 2:8393191-8393213 GTCCCAGTTACCAACTGAGGAGG + Intergenic
931288861 2:60855091-60855113 GGCCAAGAAAAGAACTGTGGTGG + Intergenic
935087780 2:99865223-99865245 GGCCCAGCCATCAGGTGTGGGGG + Intronic
937951923 2:127394786-127394808 TGCCTAGCAGCCAACTGTGTTGG + Intergenic
940106059 2:150101672-150101694 GGCCCACCAGCCGGCTGTGGTGG + Intergenic
945886560 2:215381988-215382010 AGCACAGCAACTAACTATGGTGG + Intronic
946495176 2:220189446-220189468 GGGCCAGCAACTCACTGTGCTGG - Intergenic
948838618 2:240638056-240638078 GTCCCAGCCATCCACTGTGGAGG - Intergenic
1170533043 20:17313660-17313682 GACCCAGAAAGCAACTTTGGAGG - Intronic
1171355023 20:24537304-24537326 CACCCATCAACCAACTTTGGTGG + Intronic
1173172260 20:40736881-40736903 GGCCCAGCACACATCTGTGATGG - Intergenic
1175126951 20:56759641-56759663 GGGCCAGCAACCAACCGTCAAGG - Intergenic
1175235456 20:57507483-57507505 GGCACAACAGCCAGCTGTGGGGG - Intronic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1175890986 20:62315818-62315840 GCCCCAGCTGCCCACTGTGGGGG + Intronic
1179157079 21:38859953-38859975 GTCCCAGCAGCCGGCTGTGGTGG + Intergenic
1180197736 21:46207690-46207712 GGCCCAGCCACCAAAGGTGTGGG + Intronic
1182025865 22:27118715-27118737 GGCTGAGCATACAACTGTGGAGG + Intergenic
1182371100 22:29811599-29811621 GACCCAGCCTCCAACTGTGCTGG - Intronic
1183068166 22:35378016-35378038 ACCCCAGCAACCCACTGTGTGGG + Intergenic
1183830513 22:40416288-40416310 GGCCCAGCAGGCAGCAGTGGCGG - Intronic
1183953277 22:41364414-41364436 GGCCCAGCAACCCACTGGTGTGG + Intergenic
1184604259 22:45563122-45563144 GGGCCACCACCCCACTGTGGGGG - Intronic
1184846411 22:47090530-47090552 GGCCCAGCATCCACCTGGAGGGG - Intronic
950450663 3:13063409-13063431 GTCCCAGCTGCCCACTGTGGTGG + Intronic
951512720 3:23522014-23522036 GTTCCACCAAACAACTGTGGTGG - Intronic
952818779 3:37468155-37468177 TGCCCAGCAAACACCTGGGGAGG + Intronic
952883851 3:38001220-38001242 GGCCCATCTCCCAAGTGTGGTGG + Intronic
953605896 3:44413008-44413030 GGCCAAGCCACCAAGTGTAGAGG - Intergenic
954237229 3:49266045-49266067 GTCCCAGTGCCCAACTGTGGTGG + Intergenic
955117919 3:56024345-56024367 GCCGCAGCACCCAACTGTGTTGG + Intronic
956611743 3:71130715-71130737 AGCCCAGCCAGCTACTGTGGAGG - Exonic
957233083 3:77546340-77546362 GGCCGAACCACAAACTGTGGGGG - Exonic
957674673 3:83351126-83351148 GGCCCAACAACAACCTGTGTTGG + Intergenic
970529692 4:16968981-16969003 TGCCCAGCAAGCAACACTGGAGG - Intergenic
975132964 4:70846618-70846640 GTCCCAGCTACCAGCTGAGGTGG + Intergenic
978564591 4:110068758-110068780 GGCACAGCAAAGAAATGTGGGGG + Intronic
979544860 4:121928655-121928677 GGTCCACCAGCTAACTGTGGAGG - Intronic
985577168 5:678791-678813 GGCCCAGCCGCCTACTCTGGGGG - Intronic
988051850 5:26041586-26041608 GGGCCTGCAACCAGCTGGGGAGG - Intergenic
988732329 5:33984673-33984695 GGCCGAGCAACCAACAGAGATGG + Exonic
997416914 5:133736083-133736105 GTACCAGGAACCAACTGTGCAGG + Intergenic
998266196 5:140669474-140669496 GGCCCAGCTGCGAGCTGTGGTGG + Exonic
999090710 5:148933564-148933586 GGCCCCGCCTCCAACTCTGGGGG - Intronic
1001125904 5:169019020-169019042 TGCCCAGCAACCCAGAGTGGGGG - Intronic
1006258167 6:32847585-32847607 GACCCAGAAGCCAACTATGGAGG - Exonic
1009339926 6:62541570-62541592 GCCACAGCAACCAGCAGTGGTGG - Intergenic
1015106187 6:129539553-129539575 GGCTGAGATACCAACTGTGGAGG - Intergenic
1023350353 7:39314211-39314233 GGCCAGTCAACCAACTGTGCTGG - Intronic
1023967301 7:44969661-44969683 GTCCCACCAGCCCACTGTGGTGG + Intronic
1024342570 7:48282399-48282421 GGCCCAGTAGCCCACTGAGGGGG - Intronic
1035735672 8:1885829-1885851 GGGCCAGGAACCTACAGTGGAGG - Intronic
1036525899 8:9534627-9534649 GCCCCAGCACCCAAATGAGGAGG + Intergenic
1040284928 8:46094749-46094771 GGCCCCGCCACCACCCGTGGGGG - Intergenic
1040285522 8:46098639-46098661 GGCCCAGCTGCCATCTGTGAGGG - Intergenic
1040359378 8:46650787-46650809 GACCCAGCACCCAAGTGTTGTGG + Intergenic
1047416448 8:124668153-124668175 GGCCCGGCCAGCAACTGAGGAGG + Intronic
1048984889 8:139730075-139730097 GGGCCAGCTGCCCACTGTGGCGG + Intergenic
1049423320 8:142526344-142526366 AGCCCAGCTGCCAACTGTGCAGG - Intronic
1057956394 9:99411685-99411707 AGCTCAGCAGCCAACTGTGCTGG - Intergenic
1058958415 9:109970341-109970363 CGATCAGTAACCAACTGTGGAGG + Intronic
1060992955 9:127859116-127859138 GGGCCAGCAACCAAGCCTGGGGG - Intergenic
1061771671 9:132928848-132928870 GGCCCAACAAGCAAATGTCGGGG - Exonic
1187452164 X:19408140-19408162 GGCTCTCCAACTAACTGTGGTGG - Intronic
1200868052 Y:8066575-8066597 GACCCAGCAACCAAGTGATGTGG + Intergenic