ID: 1123002146

View in Genome Browser
Species Human (GRCh38)
Location 14:105301301-105301323
Sequence CCCACCCTCAGCCCCGCATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 395}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123002146_1123002164 29 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002164 14:105301353-105301375 GCGAAGGGAACTGGAGCTGTGGG 0: 1
1: 0
2: 1
3: 21
4: 183
1123002146_1123002160 14 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 87
1123002146_1123002155 3 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002155 14:105301327-105301349 CGGGGCCTCCCGTGGAGAGACGG 0: 1
1: 0
2: 0
3: 19
4: 217
1123002146_1123002159 13 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002159 14:105301337-105301359 CGTGGAGAGACGGCCTGCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1123002146_1123002161 20 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002161 14:105301344-105301366 AGACGGCCTGCGAAGGGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 87
1123002146_1123002163 28 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002163 14:105301352-105301374 TGCGAAGGGAACTGGAGCTGTGG 0: 1
1: 0
2: 1
3: 21
4: 257
1123002146_1123002154 -5 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002154 14:105301319-105301341 GTGGGGGGCGGGGCCTCCCGTGG 0: 1
1: 1
2: 4
3: 78
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123002146 Original CRISPR CCCACCCTCAGCCCCGCATC CGG (reversed) Exonic
900103069 1:971034-971056 CCCACCCTGATCCTCGCAGCCGG + Intronic
900523155 1:3115914-3115936 CCCACCCTGTGTCCAGCATCTGG + Intronic
900774572 1:4572561-4572583 CCCAGCCTCAACCCATCATCTGG + Intergenic
901275690 1:7989266-7989288 CACACCCTCACCCCCAAATCAGG - Intergenic
901791424 1:11655241-11655263 CCCACCCCCAGCCCCGCGGCTGG - Intronic
902230392 1:15023755-15023777 CCCACCCCCACCCCCATATCTGG - Intronic
902478354 1:16699618-16699640 CCCACCTTCATCCCCGCAGGCGG - Intergenic
902575392 1:17374140-17374162 CTCACCCCCAGCCCCGCACTGGG - Intronic
902606768 1:17573422-17573444 CAGACCCTCAGCCCCACATCAGG - Intronic
902896652 1:19484703-19484725 CCCGCCCTGAGCCTCTCATCAGG - Intronic
903019991 1:20387036-20387058 CTCCCCCTCAGCCCTGCCTCGGG - Intergenic
903132651 1:21289938-21289960 CCCTCCCTCGTCCCGGCATCCGG - Intronic
903657476 1:24958156-24958178 CCTACCCTGAGCCCCGCATGTGG - Intronic
903863258 1:26378523-26378545 CCCACCCTCAGCTCTGCCTGTGG - Intergenic
904330615 1:29755779-29755801 CCCTCCCTGAGCCCCGCAGCTGG + Intergenic
904416059 1:30361816-30361838 CCCTCCCTGAGCCCCACAGCTGG - Intergenic
905438753 1:37979110-37979132 CCCACCCTCTGGCCTGCATTTGG - Intronic
905629519 1:39510941-39510963 CTCACCCTGAGCCCTGCACCTGG - Intronic
905668241 1:39775249-39775271 CTCACCCTGAGCCCCGCAGCTGG + Intronic
906296781 1:44653586-44653608 CCTAACCTCAGCTCCTCATCTGG + Exonic
906514918 1:46433174-46433196 CTCACCCTCTGCCCTGAATCAGG - Intergenic
908769149 1:67580720-67580742 CCCATCCTGGGCCCAGCATCTGG + Intergenic
909585315 1:77282236-77282258 CCCAGCTTCAGCCCCGGCTCAGG + Exonic
910366284 1:86468696-86468718 CCCACCCTTACCCCAGCATCTGG + Exonic
911926511 1:103838775-103838797 CCCTCCCCCAGCCCCCCAACAGG - Intergenic
912411414 1:109483316-109483338 CCAACCCTCTGCTCTGCATCAGG + Intergenic
913317228 1:117563483-117563505 CCCACCCTCACTCCCGCCTCTGG + Intergenic
913664531 1:121035161-121035183 CCCAGACTCAGCCCCAGATCTGG - Intergenic
914015925 1:143818439-143818461 CCCAGACTCAGCCCCAGATCTGG - Intergenic
914161858 1:145142569-145142591 CCCAGACTCAGCCCCAGATCTGG + Intergenic
914654542 1:149726980-149727002 CCCAGACTCAGCCCCAGATCTGG - Intergenic
916216498 1:162399656-162399678 CCCACCCTGAGCCCTCCAACAGG + Intronic
916278577 1:163023545-163023567 CCCAGGCTCATCCCAGCATCAGG - Intergenic
918118074 1:181514078-181514100 GCAACCCTCAGCCCCTCAGCAGG - Intronic
918530675 1:185517669-185517691 CCCTCCCTCAACCCCACAACAGG - Intergenic
919253846 1:195096378-195096400 GCCACCCTCAGCCCCCCTTCAGG - Intergenic
920132505 1:203743330-203743352 CCCACCCTCACCAATGCATCGGG - Exonic
920315570 1:205073775-205073797 CCCTCCCTCTGCGCCGCAGCTGG + Exonic
920931675 1:210394568-210394590 CCCACCCTCAACCCTACACCAGG - Intronic
921179984 1:212624686-212624708 CCCACCCCCACCCCGGCCTCTGG + Exonic
921338042 1:214107878-214107900 CCCACCCCCAGCCCAGCTCCTGG + Intergenic
921842134 1:219839750-219839772 CCCTCCCTCAGCCTCGCTGCCGG - Intronic
922534600 1:226370592-226370614 CCCACCCTCAGGCCCCCAACAGG + Intronic
922678577 1:227570170-227570192 GCCACACTCATCCACGCATCTGG - Intronic
923340846 1:233005821-233005843 CCCACCCTCAGGCCAACAGCTGG + Intronic
1063416635 10:5878276-5878298 TCACCCCTCAGCCCTGCATCTGG - Exonic
1063435016 10:6022442-6022464 CCCACCCACAGCCCCCAACCTGG + Intronic
1063606353 10:7526277-7526299 GCCACCCTCAGCCCCGCTGCTGG + Intergenic
1067088258 10:43254035-43254057 CCCACCCTCAGGCCCACAGAGGG + Intronic
1067148756 10:43712308-43712330 CCCACCCTGAGCCCAGCCCCAGG - Intergenic
1067414290 10:46091915-46091937 CCCATCCTCAGCTCTGCATCGGG + Intergenic
1067434350 10:46266458-46266480 CCCACCCTCAGCTCTGCATCGGG + Intergenic
1067495129 10:46754823-46754845 CCCACCCCCAGCCCCTCAGCAGG + Intergenic
1067576091 10:47409539-47409561 CCCATCCTCAGCTCTGCATGGGG - Intergenic
1067581598 10:47449970-47449992 CCCATCCTCAGCTCTGCATCGGG - Intergenic
1067599525 10:47585573-47585595 CCCACCCCCAGCCCCTCAGCAGG - Intergenic
1068495871 10:57784822-57784844 CCCTCCCCCAGGCCCCCATCTGG - Intergenic
1069775679 10:70925882-70925904 CCCACCCTCAGCCCTGGGACTGG + Intergenic
1070642107 10:78177654-78177676 CCCGCCCACAGCCCAGCATGGGG + Intergenic
1071508740 10:86248239-86248261 CCCACCTTCACCCCCGCAGCAGG + Intronic
1071651055 10:87393455-87393477 CCCACCCCCAGCCCCTCAGCAGG - Intergenic
1073429546 10:103477217-103477239 CCCACCCTCTGACCGGCCTCAGG + Intronic
1074354324 10:112768681-112768703 CCCACCCTCACCCCTGCTCCAGG - Intronic
1074381660 10:112985707-112985729 CCCACCCACAGCCTCGCCCCAGG - Intronic
1074439937 10:113469153-113469175 CCCACCCCCATCCCCACCTCAGG + Intergenic
1074635817 10:115316106-115316128 CTCACCCCCAGCCCGGCAACAGG + Intronic
1075401327 10:122163481-122163503 CCCACCCCCAGCCCCGTTTCCGG + Intronic
1075549310 10:123380243-123380265 CGCACACTCAGCTCCCCATCTGG + Intergenic
1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG + Intronic
1076469752 10:130710185-130710207 CCCACCCTCAACCCCACCTGGGG - Intergenic
1076830632 10:132992574-132992596 CACCCCCTCAGCCCCGAGTCTGG + Intergenic
1076845519 10:133067770-133067792 CCCACCCCCTGGCCCGCACCAGG - Intergenic
1076925598 10:133482644-133482666 CCCACACTCTTCCCAGCATCTGG + Intergenic
1077244312 11:1528734-1528756 CCCACCCTCAGCACCACTCCTGG + Intergenic
1077484938 11:2834311-2834333 CTCAGCCTCAGCACCGCACCTGG - Intronic
1077538299 11:3134824-3134846 CCCACCCTCAGCCCCTCTCTGGG - Intronic
1078622699 11:12923538-12923560 CCAACCCCCTGCTCCGCATCCGG - Intronic
1079082624 11:17424557-17424579 CCCACCCTCATGCCCTCATGTGG - Intronic
1079390272 11:20016230-20016252 TCCACCCTCAGTCCAACATCAGG - Intronic
1081568986 11:44278087-44278109 ACCTCCCTCAGCCCCTCATCTGG - Intronic
1081576655 11:44322908-44322930 CCCACCCTGAGCCCCCACTCTGG - Intergenic
1083490000 11:63009138-63009160 CCCACCCTCAGCCCTGCCGGGGG - Intronic
1083746453 11:64739671-64739693 CAAACCCACAGCCCCGCAGCGGG - Exonic
1083962583 11:66022575-66022597 CCCGCCCTCAGCCGCACATTTGG + Intronic
1084003813 11:66313058-66313080 CCCGCACGCAGCTCCGCATCTGG + Intergenic
1084411097 11:69006304-69006326 CCCACCCACAGACCTGCATCTGG + Intronic
1084692221 11:70734102-70734124 CACCCCCTGAGCCGCGCATCTGG + Intronic
1084727619 11:70952198-70952220 CCCACTCTCAGCCACAGATCTGG - Intronic
1084833497 11:71787136-71787158 CCCACCCTAACGCCCGCCTCCGG + Intergenic
1084937739 11:72596015-72596037 CCCAGCCTCAGCCCTGGGTCTGG + Intronic
1084993085 11:72947301-72947323 CTCACACTCAGGCCCACATCTGG + Intronic
1085064138 11:73476443-73476465 CCCACCCCCACCCCACCATCAGG - Intronic
1088678535 11:112219786-112219808 CCCACCCTCAGCTCGGCTTTGGG + Intronic
1089218084 11:116847800-116847822 CCCACCCTCAGCCCCCCCACTGG - Intronic
1089645424 11:119875701-119875723 CCCTCCATCAGCCCCGCCTCTGG + Intergenic
1089688236 11:120170216-120170238 CCCTCCCCCAGCCCCGCCTCTGG - Exonic
1089758632 11:120706550-120706572 CCCACCAACAGCCCCTCACCTGG - Intronic
1090393270 11:126403136-126403158 CTCACCCTCAGCCCCACAAGGGG + Intronic
1091218718 11:133918603-133918625 CCCACCCGCAGCCCCACCGCGGG - Intronic
1091498279 12:991161-991183 CCCGCCCCCAGCCCCGCCGCGGG - Intronic
1091575771 12:1733755-1733777 CCCTCCCTCAACCCCACAACAGG + Intronic
1092117240 12:6018364-6018386 CCCACCCTCTCCCCTGCACCTGG - Exonic
1095283131 12:40380353-40380375 CCCTCCCTCCGCCCCCCAACAGG - Intergenic
1095980862 12:47974022-47974044 CCAACCCTCAGCCCTGCTCCAGG + Intronic
1096255405 12:50059143-50059165 CCCTCCCTCAGCCCTGCTCCTGG + Intronic
1096571041 12:52523346-52523368 CACACCCTCAGCCCAGCCTTGGG + Intergenic
1096665428 12:53160944-53160966 CTCACCCTCACCCCAGCATCAGG + Intronic
1096741552 12:53697333-53697355 CCCATCCCCAGCCCCGACTCAGG - Intergenic
1096841033 12:54379247-54379269 CCCGTCCTCGGCCCCGCCTCCGG - Intronic
1097265175 12:57740200-57740222 CCCACCCTCAGCCCCCCACCAGG - Intronic
1097288153 12:57893450-57893472 CCCACACTCAGCCCAGGACCTGG - Intergenic
1102119600 12:110429841-110429863 CCCACCATCACCACCGCCTCTGG - Intergenic
1102509352 12:113403736-113403758 CCCATCCTCAGTCCCACCTCAGG - Intronic
1103373682 12:120438493-120438515 CCTACCCCCATCTCCGCATCAGG + Exonic
1103509891 12:121467127-121467149 CCCTCCCTCAGCCCCACCCCGGG + Intronic
1104811416 12:131622308-131622330 TCCAGCCTCTGCCCCGCAACAGG + Intergenic
1104943302 12:132404792-132404814 CCCACCCTCAGCCCCCTCTGAGG + Intergenic
1105703163 13:22948848-22948870 CTCACCCTCAGCCCCGTGGCAGG - Intergenic
1105816966 13:24044879-24044901 CCCACCCCCACCCCCTCCTCTGG - Intronic
1105855861 13:24371332-24371354 CTCACCCTCAGCCCCGTGGCAGG - Intergenic
1106411471 13:29514303-29514325 CCCACCCTCGGCTCTGCAGCCGG - Exonic
1107210509 13:37848621-37848643 CACACCCTCATCCCATCATCTGG + Intronic
1108218244 13:48206850-48206872 CCAACCCTCCACCCCGCAACAGG - Intergenic
1108853518 13:54765272-54765294 CCTTCCCTCAGCCCAGCTTCAGG - Intergenic
1109085295 13:57963435-57963457 CCCACCCTCCACCCCACAACAGG - Intergenic
1111220992 13:85205337-85205359 TCCACCCACAGCCCCGGAGCGGG + Intergenic
1113126978 13:106990188-106990210 CTCACCCCCAGCCCAGCACCAGG - Intergenic
1114368184 14:22053450-22053472 CCCACCCTCCTCCCAGCCTCTGG + Intergenic
1118312570 14:64704557-64704579 CCCACCGCCAGCCCCTCAGCTGG - Exonic
1119551269 14:75515589-75515611 CCCACGCTCAGGCCCGCACCAGG + Intergenic
1119569856 14:75660883-75660905 CCCTCCCTCAGCCCTGCTCCAGG + Exonic
1120852016 14:89180103-89180125 TCCACTGTCAGCCCCGGATCAGG - Intronic
1120996541 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG + Intergenic
1121019302 14:90569352-90569374 CACAGCCTCAGCCCTGCATATGG - Intronic
1121338620 14:93092164-93092186 CCCACGCTAAGCCCAGCATGGGG + Intronic
1121434848 14:93912257-93912279 CCCAGCCTCATCCCCGAAACTGG - Intergenic
1122199682 14:100114786-100114808 CCCACCCCCACCCCCGGAGCAGG - Intronic
1123002146 14:105301301-105301323 CCCACCCTCAGCCCCGCATCCGG - Exonic
1202881811 14_KI270722v1_random:67640-67662 CCCAGCCTCAGGACCGCCTCTGG - Intergenic
1124632888 15:31347350-31347372 CCCATCCCCAGCCCTGCCTCAGG - Intronic
1127447951 15:59084776-59084798 CCCACCCTCTCCCCAGCCTCTGG + Intronic
1128367396 15:67013997-67014019 CCCTCCCTCAGCCCCACTGCAGG - Intergenic
1129154384 15:73708913-73708935 CTGACCCTCAGCCCCGCAAATGG - Intronic
1130048490 15:80464306-80464328 CCCACCCCCAGCCCCCAATCGGG - Intronic
1130991147 15:88876895-88876917 CCCACTCCCACCCCCGCCTCAGG - Intergenic
1131830972 15:96354348-96354370 CCCACACTCGGCTCCGCAGCCGG + Intergenic
1131832543 15:96363012-96363034 CCCAACCTCAGCCCCAGATCGGG - Intergenic
1132400725 15:101503302-101503324 CCCACCCTGATCCCTGCCTCTGG + Intronic
1132439242 15:101842175-101842197 CCCAACCCCAGCCCCACAACAGG + Intergenic
1132498165 16:273612-273634 CCCACCCTCAGGCCTGGACCTGG + Intronic
1132589125 16:718742-718764 CCCACCTTCTGCCCCTCCTCAGG + Exonic
1132616310 16:842697-842719 CCGACCCTCAGACCCTCCTCGGG + Intergenic
1132729533 16:1354648-1354670 CCCACCCCCATCCCCACATCAGG + Intronic
1132868368 16:2104728-2104750 CCCACCCCCAGCCCTGCAGCTGG + Intronic
1132889254 16:2196115-2196137 GCCACCGTGAGCCCCGCAGCGGG - Intronic
1132995009 16:2818268-2818290 CCCACCCTCATCCCCCCTCCTGG + Intronic
1133036169 16:3035561-3035583 CTCACCCTCCGCCCAGCACCTGG + Intronic
1133139053 16:3731157-3731179 CCCACCCCCACCCCCACAGCCGG - Intronic
1133881564 16:9787400-9787422 CCCACCCTCTACCCCACTTCGGG + Intronic
1134523361 16:14928273-14928295 CCCACCTCCAGCCCTGCAGCTGG - Intronic
1134710955 16:16326757-16326779 CCCACCCCCAGCCCTGCAGCTGG - Intergenic
1134948628 16:18341852-18341874 CCCACCCCCAGCCCTGCAGCTGG + Intergenic
1135359200 16:21796889-21796911 CTCCCCCTCTGCCCCACATCTGG - Intergenic
1135457752 16:22613326-22613348 CTCCCCCTCTGCCCCACATCTGG - Intergenic
1135544435 16:23356194-23356216 CCCACCCTGATCCCCTCATCGGG - Intronic
1136498784 16:30659492-30659514 ACCGCCCTCAGCGCCGCATCCGG - Exonic
1136618135 16:31410896-31410918 CCCACCCTCATCCTCCCCTCTGG - Intronic
1136690503 16:32025021-32025043 CCCACCCTCAGCCCTGTGACTGG - Intergenic
1136791090 16:32968581-32968603 CCCACCCTCAGCCCTGTGACTGG - Intergenic
1136878724 16:33885351-33885373 CCCACCCTCAGCCCTGTGACTGG + Intergenic
1137270874 16:46901622-46901644 CCCACCCTCAGCTCCACTTTCGG - Intronic
1137683311 16:50369095-50369117 CCCGCCCTCGGCCCCGCCCCCGG - Intergenic
1138207004 16:55132638-55132660 CCCATCCTCCACCCCGAATCAGG - Intergenic
1138287468 16:55821225-55821247 CCTACTCACAGCCCAGCATCAGG - Intronic
1138448448 16:57078974-57078996 CCCACCCTCAGCCTTGTCTCAGG - Intronic
1138562303 16:57808885-57808907 AGCACCCTCAGCCCAGCATCTGG + Intronic
1139532222 16:67547991-67548013 CCCACCCTCGCCCCAGCGTCTGG - Intergenic
1139565921 16:67776168-67776190 ACCACACCCAGCCCTGCATCTGG - Intronic
1141141000 16:81496909-81496931 CCCACCCACAGCCTGGCAGCTGG + Intronic
1141152630 16:81574694-81574716 CCCAGCACCAGCCCAGCATCCGG - Intronic
1141630895 16:85287435-85287457 TCCACCCACACCCCCGCCTCTGG + Intergenic
1141861255 16:86718027-86718049 CCCACCCTAAGTCCCCCATGAGG - Intergenic
1142114328 16:88348515-88348537 GCCACCCTCAGCCCCAGAACTGG + Intergenic
1142345682 16:89552542-89552564 CTCCCCCACAGCCCCACATCAGG - Intronic
1203093298 16_KI270728v1_random:1230042-1230064 CCCACCCTCAGCCCTGTGACTGG - Intergenic
1142534825 17:606868-606890 CCCACCCCCACCCCCACCTCTGG + Intronic
1143114491 17:4574975-4574997 CCCATCCCCAGCCCACCATCAGG + Intergenic
1144766083 17:17733321-17733343 CCCACGCAGTGCCCCGCATCTGG - Intronic
1144828203 17:18118298-18118320 CCCACCCTAGGCCCCACTTCTGG + Intronic
1145223270 17:21106508-21106530 CCCAGCCCCACCCCCGCTTCAGG - Intergenic
1145795475 17:27653127-27653149 CTCACCCTCATCCCCCCAGCAGG - Intergenic
1145809912 17:27758458-27758480 CTCACCCTCATCCCCCCAGCAGG - Intronic
1146266696 17:31457692-31457714 CTCACCCCCAGCCCCGCAGGTGG + Intronic
1147133096 17:38420256-38420278 CCCTCGCTCTGCCCCCCATCAGG - Intergenic
1147135027 17:38429303-38429325 CCCAGCCCCATCCCCCCATCAGG + Intronic
1147153362 17:38531157-38531179 CCCACCCTCAGCCCTGTGACTGG - Exonic
1147184788 17:38707200-38707222 CCCTCCCTCTGCCCCACCTCAGG + Intronic
1147254806 17:39175259-39175281 CCCACCCTCAGCGCAGTAGCGGG + Exonic
1147256454 17:39184974-39184996 CCCACCCTGATCCCTACATCTGG - Intronic
1147927285 17:43953696-43953718 CCCACCCCCACCCCCGCTGCTGG + Intronic
1148018513 17:44538933-44538955 CCCACCCCCACGCCCGCCTCAGG + Intergenic
1149513689 17:57263811-57263833 CCAACCCTCAACTCCACATCTGG + Intronic
1150493311 17:65589099-65589121 CTCACTCTCATCCCCACATCTGG - Intronic
1150636392 17:66916226-66916248 CCCACCCTCAGGCCCACCTCCGG + Intergenic
1151472345 17:74326168-74326190 CCCTCCCCCTGCCCCGCCTCGGG + Intergenic
1152239312 17:79153196-79153218 CCCACCCCCAGCCAAGGATCTGG - Intronic
1152525793 17:80887599-80887621 CCCAACCCCAGCCCCACAGCAGG - Intronic
1152771464 17:82172215-82172237 CCCACCCACAGCCACTCATGGGG + Intronic
1153928169 18:9854126-9854148 CCCACCCCCAACCCCTCAACAGG + Intronic
1154038796 18:10833447-10833469 GCCACCTTCAGCCCCGCCCCAGG - Intronic
1154400095 18:14028613-14028635 CCCACCCTCAGCCCCATGGCAGG + Intergenic
1155074358 18:22341879-22341901 CCCACCCTCCCACCCTCATCTGG - Intergenic
1155163911 18:23217896-23217918 CTCACCCACAGCCCCACACCTGG + Intronic
1156114815 18:33775051-33775073 CCCTCCCCCAGCCCCACAACAGG - Intergenic
1156682830 18:39611692-39611714 CGCCCCCTGAGCCCCGCAACAGG - Intergenic
1157300399 18:46474823-46474845 CGCACGCTCAGCCCCACAGCAGG - Intergenic
1157387067 18:47266319-47266341 CCCACCCCCACCCCGGCCTCTGG - Intergenic
1157480370 18:48050074-48050096 CCCAACCTCATTCCCACATCTGG - Intronic
1158941954 18:62412691-62412713 CCCATCCTCAGCCCTTCCTCAGG + Intergenic
1159782794 18:72678513-72678535 CGCAAGCTCAGCCCCGCATGAGG - Intergenic
1160068235 18:75598338-75598360 TCCACCCTGAGCCCTACATCTGG + Intergenic
1160720872 19:596431-596453 CCCAGCCTCATCCCGGCCTCCGG + Intronic
1160818392 19:1046734-1046756 CCCCCCCTCCGCCCACCATCTGG - Intronic
1161208892 19:3056237-3056259 CCCACCTCCAGCCCCGCCTTGGG - Intronic
1161388929 19:4011299-4011321 CCCACCCTTAGCCCTGAAGCTGG - Intronic
1161846295 19:6713630-6713652 CCCACCTCCAGCCCCTCACCTGG + Intronic
1161846328 19:6713701-6713723 CCCACCTCCAGCCCCTCACCTGG + Intronic
1161846408 19:6713867-6713889 TCCACCCCCAGCCCCCCACCTGG + Intronic
1161846450 19:6713973-6713995 CCCACCCCCAGTCCCTCACCTGG + Exonic
1161861526 19:6801689-6801711 CCCACCCCCACCCCAGCACCAGG - Intronic
1162152214 19:8654786-8654808 CTCAACCCCAGCCCCGCCTCGGG + Intergenic
1162176332 19:8832685-8832707 CCCACCCACAGCCCCGACCCTGG - Intronic
1162257040 19:9498831-9498853 CCCACCTCCAGCCCCGCCCCCGG - Intergenic
1162968680 19:14167560-14167582 CCCACCCTCAGCCAAGAAACAGG + Intronic
1163522934 19:17802664-17802686 CCCAAGCTCAGCCCTGCCTCAGG - Intronic
1164147516 19:22521185-22521207 CCCACCATCACCCCAGCAGCTGG + Intronic
1166063612 19:40343218-40343240 TCCTCCCTCACCCCCGCATGGGG + Intronic
1166369935 19:42295009-42295031 CCCACTCCCAGCCCCGCAGGGGG + Exonic
1166510120 19:43401558-43401580 CCGGCCCTCAGCCACGCACCTGG - Exonic
1166719347 19:44988363-44988385 CCCTCCCTCAGCTCCACACCCGG - Intronic
1166764665 19:45245572-45245594 CCCACCCTCACCCCCGCTCCAGG + Intronic
1166844579 19:45718768-45718790 CCCACACTGAGCCCAGCATAAGG + Intronic
1166884960 19:45954559-45954581 CCACCCCTCAGCCCTCCATCTGG - Intronic
1167095464 19:47373004-47373026 CCCACCCTCAGCCCCACCCTGGG + Intronic
1167134615 19:47609333-47609355 CTCACACTCAGCCCCCCAGCCGG + Intronic
1167158826 19:47754987-47755009 CACACCCCAAGCCCCGCATGTGG + Intronic
1167504095 19:49862341-49862363 CCCACCCCCACCCCCGCCCCAGG + Intronic
1167906072 19:52661776-52661798 CCCACCTTCACCCCCACCTCTGG - Intronic
1167958465 19:53086990-53087012 CCCACCTTCACCCCCACCTCTGG - Intronic
1202657420 1_KI270708v1_random:36739-36761 CCCAGCCTCAGGACCGCCTCTGG - Intergenic
1202712376 1_KI270714v1_random:25449-25471 CCCACCTTCATCCCCGCAGGCGG - Intergenic
925903112 2:8522740-8522762 CCCAACCTCACCCCAGCACCTGG + Intergenic
927847873 2:26480614-26480636 CCCCCACTCAGCCCCGCAACAGG - Intronic
928553181 2:32394717-32394739 TCCAACCTCAGCCCCCCAGCTGG - Intronic
928829701 2:35465607-35465629 CCCACCCTCACCCCTGAGTCTGG - Intergenic
930307339 2:49692005-49692027 CTCACCCTCCACCCCGCAACAGG + Intergenic
931739256 2:65227645-65227667 CCCTCCCGCAGCTCCGCTTCCGG - Intergenic
932002031 2:67893904-67893926 CCCTTCCTCATCCCCTCATCAGG + Intergenic
933787165 2:85852562-85852584 CCCACCCTCAACCCCACCCCAGG - Intronic
934857747 2:97739538-97739560 CCCACCCTCAGCCCCACCCCAGG + Exonic
934977035 2:98810040-98810062 CCCTCCCTCATCCCAGCACCTGG + Intronic
936512849 2:113162366-113162388 CCCACCCTCTGCCCAGTAGCTGG + Intronic
937281808 2:120722425-120722447 CCCACCCAGAGCCCCTCACCCGG - Intergenic
937367200 2:121271996-121272018 CCCTCCCTCAGAGCTGCATCAGG + Intronic
938066810 2:128285835-128285857 CCCACCCTCAGGCCGGCAGTGGG + Intronic
938073209 2:128318973-128318995 CCGATCCTCGGCCCCGCCTCCGG + Intergenic
938246107 2:129779215-129779237 CCCACCCTCACCCCTGAAGCTGG - Intergenic
939779213 2:146423774-146423796 CCCACCCACAGCCCTCCAACAGG - Intergenic
942055595 2:172179511-172179533 CCCACCCTCAGCCCTCCCTGTGG + Intergenic
947592448 2:231393410-231393432 CCCACCCCCACCCCACCATCAGG + Intergenic
948329164 2:237151438-237151460 CGCACCCTCACCCCCGGATGTGG + Intergenic
948608214 2:239149601-239149623 GCCACCCTGTGCCCAGCATCTGG - Intronic
948657075 2:239483142-239483164 CCCACCGTCAGCTCCACCTCTGG - Intergenic
948824280 2:240566809-240566831 GCCACCCAGAGCCCCGCATTGGG - Intronic
948883490 2:240871813-240871835 GCCTCCCTCATCCCCGCATGGGG + Intronic
948942873 2:241204752-241204774 ACCACCCTCAGCCCAGCTTGGGG - Intronic
1171112735 20:22499470-22499492 CTGAGCCTCAGCCCCTCATCCGG + Intergenic
1171359431 20:24576727-24576749 CCCACCCTCAGCAGTGCCTCAGG + Intronic
1171523281 20:25791822-25791844 CCCAGCCTCAGGCCCGGATTCGG - Intronic
1171531023 20:25853797-25853819 CCCAGCCTCAGGCCCGGATTCGG - Intronic
1171553545 20:26064061-26064083 CCCAGCCTCAGGCCCGGATTCGG + Intergenic
1172303076 20:33863349-33863371 CCCACCCCCAGCCCTGCATCTGG + Intergenic
1172638809 20:36428570-36428592 CCCACCCTCTGCCCCTCAGCTGG + Intronic
1173497218 20:43528484-43528506 CCTCCCCTCAGCCCCGTGTCTGG + Intronic
1173624905 20:44465720-44465742 CTCACCCTCAGGCCTGCTTCAGG + Intergenic
1173727225 20:45306585-45306607 ACCACGCTCAGCCCCGCAACAGG - Intronic
1174204782 20:48830249-48830271 CCCCACCTCAGCCCAGCAGCTGG - Intergenic
1174579923 20:51564137-51564159 CCCACCCCCAGCCCCGCCCAGGG + Intergenic
1174782967 20:53406970-53406992 CCCAAACTCAGCCCCACTTCAGG + Intronic
1175203375 20:57292736-57292758 CCCAGCCTCAGGCCCACATCTGG + Intergenic
1175442612 20:59002128-59002150 CCAGCCCTCAGGACCGCATCTGG - Intronic
1175992576 20:62796907-62796929 CCCACCCCCACCCCCGCCCCGGG + Intronic
1176299928 21:5094791-5094813 CCCACCCACAGCCCCTCCTCCGG + Intergenic
1179453940 21:41485536-41485558 CCCAGCCTCAGCCCCCCAAGTGG - Intronic
1179857094 21:44167120-44167142 CCCACCCACAGCCCCTCCTCCGG - Intergenic
1181030573 22:20147306-20147328 CCCACCCCCAGCCCTGCCCCAGG - Exonic
1181160514 22:20957286-20957308 CTGGCCCTCAGCCCCGCCTCAGG - Intergenic
1181363664 22:22357641-22357663 CCCACCCTGAGCCCTGGGTCAGG - Intergenic
1181366478 22:22380724-22380746 CCCACCCTGAGCCCTGGGTCAGG - Intergenic
1181372848 22:22431841-22431863 CCCACCCTGAGCCCTGGGTCAGG - Intergenic
1181482857 22:23212019-23212041 CCTACCCTCAGCCTCCCATAAGG + Intronic
1181486472 22:23234785-23234807 CTCACACACACCCCCGCATCAGG - Intronic
1181512733 22:23396072-23396094 CCCACCCCCAGCCCTGCCCCAGG + Intergenic
1181545020 22:23597786-23597808 CCCAGCCCCAGCCCCCCACCAGG - Intergenic
1181636703 22:24177938-24177960 CCCACCCTCACCCCTGCCCCAGG - Intronic
1181815291 22:25432096-25432118 CCCAGCCCCAGCCCCCCACCAGG + Intergenic
1181966326 22:26658668-26658690 CCCACCCTCATCCCAGGCTCCGG + Intergenic
1182095711 22:27623975-27623997 CCCACCCCCAGCCCAGCCCCTGG + Intergenic
1182664166 22:31944998-31945020 CCCACCCTGGGCCCAGCCTCAGG - Intronic
1182748203 22:32621935-32621957 ACCATCCTCAGCCCCACCTCTGG - Intronic
1183411154 22:37655638-37655660 TCCCCCCTCAGCCCCGCCCCAGG + Exonic
1183593217 22:38793887-38793909 CCCACCCTCACCCCCACTTCGGG - Intronic
1184276347 22:43411605-43411627 CCCGCCCCCAGCCCCGGACCGGG - Intronic
1184944797 22:47795564-47795586 CCCACCATCGGCCCGGCCTCAGG - Intergenic
1185294741 22:50047526-50047548 CCCACCTGCAGCCCCACATCGGG - Intronic
1185366299 22:50438505-50438527 CTCACCCTCAGCCCCGAGCCTGG + Intronic
949539396 3:5020407-5020429 ACCACCACCAGCCCAGCATCTGG + Intergenic
950682413 3:14594304-14594326 CCCTCCCTCAGCCCTGCCCCGGG + Intergenic
951640592 3:24830335-24830357 CCCACCCCCACCCCCACCTCCGG - Intergenic
952771521 3:37005896-37005918 CCCACCCTCACTCCCACCTCAGG + Intronic
954145160 3:48630864-48630886 CCCACCCTCAGTCCCCCACGTGG + Intronic
954934414 3:54313501-54313523 CCCACCCACCTCCCCACATCAGG + Intronic
955052614 3:55427180-55427202 CCCCCCCTCAGCCCCCCGTTTGG - Intergenic
955216055 3:56985831-56985853 CCCACCCCCAGCCCCACCTGTGG - Intronic
955543727 3:60005127-60005149 CTCACCCTCATCCCTGCTTCAGG + Intronic
958562070 3:95759763-95759785 GCCACCCTTAGCCCCTCATTTGG + Intergenic
959583678 3:108006314-108006336 CACACCCACAGCACCGTATCTGG + Intergenic
961259802 3:125593156-125593178 CCCACCCACAGCCCCATAGCAGG + Intronic
963107768 3:141660794-141660816 TCCACTCTCAGCCCCTCCTCCGG + Intergenic
963130525 3:141853784-141853806 CCGACCCTTTGCCCAGCATCAGG - Intergenic
966146040 3:176813277-176813299 CCCAGCCTTATCCCAGCATCTGG + Intergenic
966249881 3:177853007-177853029 CCCTCCCCCAACCCCGCAACAGG - Intergenic
969071358 4:4541972-4541994 CGCACCCTCAGCCCCACACTAGG + Exonic
969229628 4:5820978-5821000 CCCATCGTCAGCCCCGAATGGGG + Exonic
969573993 4:8025778-8025800 CCCACCTTCAGCCCTCCTTCTGG - Intronic
971878094 4:32330174-32330196 TCCACCCTCACCCCCCCACCAGG + Intergenic
972532942 4:39977202-39977224 TCCACCCTCAGCCCCACGCCAGG + Intronic
978968104 4:114767812-114767834 CCCACCCTCTGCCCTGCAATAGG - Intergenic
984964373 4:185127863-185127885 CGCACCCTCAGTCCCGCCTCAGG - Intergenic
985248136 4:187996923-187996945 CTCACCGTCAGCCCCGCGCCTGG + Intronic
985493174 5:190987-191009 CCCACACTTCGCCTCGCATCTGG - Intergenic
985512851 5:321887-321909 CCGTCCCTCAGCCCCACACCCGG - Intronic
986025164 5:3843816-3843838 CCCACGCTCAGCCCTGTGTCTGG + Intergenic
986027826 5:3866806-3866828 CCCACCCTCAGCCCCACCCCAGG - Intergenic
986295539 5:6434839-6434861 CCTTCCCTGAGCCCCGCATCAGG + Intergenic
986839544 5:11680326-11680348 CCCACCCACACCCCCACATTTGG + Intronic
987181502 5:15372788-15372810 GCCACCCTCAGCCCCACCCCTGG - Intergenic
989098271 5:37800929-37800951 CCCCTCCTCAGCCCAGCATCTGG - Intergenic
989648923 5:43666548-43666570 TCCAGCCTCAGCTCGGCATCAGG + Intronic
991346234 5:65671637-65671659 CCCACCCCCACCCCCGCCCCCGG - Intronic
992481037 5:77152770-77152792 CTCACCCTCACCTCCGCAGCCGG + Intergenic
993615506 5:90106146-90106168 CCCTCCCTCTGCCCCACAACAGG - Intergenic
993624210 5:90204836-90204858 CCCACCCTCAGCCCCACAGCAGG + Intergenic
993904162 5:93604486-93604508 GCCCCCCTCAGCCTCGCAGCCGG - Intergenic
994262750 5:97679413-97679435 CCCTCCCCCAACCCCGCAACAGG + Intergenic
996109056 5:119543262-119543284 CCCACCTTCACCCCTGCAACAGG + Intronic
997381216 5:133439843-133439865 CCCACCCTCTTCCCCACACCTGG + Intronic
998007390 5:138666013-138666035 CACACCCTCAGCCCCACTGCTGG - Intronic
998230315 5:140357511-140357533 CCTACCCCCAGCCTCGCGTCTGG - Intergenic
999282938 5:150376663-150376685 CCCATCCTCAGCCCTGGCTCAGG - Intronic
999437967 5:151578972-151578994 CCCACCCTCACCCCAGCCACTGG - Intergenic
1000640766 5:163699108-163699130 CCCACTCTCTTCCCCTCATCAGG + Intergenic
1003107899 6:3229307-3229329 CCCACCCTCCACCCCACAGCGGG - Intronic
1006474316 6:34244980-34245002 CCCACCATCACCACCGCCTCTGG + Exonic
1006831081 6:36968730-36968752 CCCCCGCTCAACCCCACATCTGG + Exonic
1006843242 6:37045077-37045099 CCTACCCCCATCTCCGCATCAGG + Exonic
1006950925 6:37820176-37820198 CCCACCCCCAGCTCCCCACCCGG - Intronic
1007655066 6:43446771-43446793 CCCACCCCCTGCCCTGCATCTGG + Intronic
1007780138 6:44247870-44247892 CCCTCCCTCGCCCCAGCATCCGG - Exonic
1008630526 6:53359495-53359517 CTCACCAACAGCGCCGCATCTGG + Intergenic
1010811881 6:80310252-80310274 CCAACCCAAAGCCCTGCATCAGG + Intronic
1011753403 6:90475730-90475752 CCCACCCTCTGCCCAGCATAGGG + Intergenic
1013234396 6:108184360-108184382 CCCACCTGCAGCCCTGCATGTGG - Intronic
1015808007 6:137131997-137132019 ACCAGCCTCTGCCCCACATCCGG + Intergenic
1017708576 6:157147186-157147208 CCATCCCTCACCCCCGCCTCCGG + Intronic
1017708635 6:157147340-157147362 CCGTCCCTCACCCCCGCCTCCGG + Intronic
1017708671 6:157147436-157147458 CCGTCCCTCACCCCCGCCTCCGG + Intronic
1017708694 6:157147500-157147522 CCGTCCCTCACCCCCGCCTCCGG + Intronic
1018246972 6:161832913-161832935 CCCACCCTCAGCCAGACATTCGG - Intronic
1018697947 6:166405398-166405420 CCCACCCTCACCCCCTGAGCTGG + Intergenic
1019342732 7:516208-516230 CCCACCCTCCGCCCCCGATAAGG + Intronic
1019348432 7:541780-541802 CCCACCCTGAGCACAGCAGCTGG - Intergenic
1019780765 7:2938471-2938493 CCCACCCCCAGGCCCTCATCTGG + Intronic
1020013148 7:4817130-4817152 CCCTCCCTCAGCCCCCCAGAAGG + Intronic
1020213072 7:6169895-6169917 GCCACTCTCAGCCCCGCCCCTGG + Intronic
1023030298 7:36084989-36085011 CCCAGCCACTGCCCCGCCTCAGG + Exonic
1024261556 7:47577493-47577515 CCCACCCACAGCCCAGCCCCTGG - Intronic
1026841430 7:73671542-73671564 CCCACCCCCAGCCCCCTCTCGGG - Exonic
1030472288 7:109980217-109980239 CCCTCCCTCAACCCCACAACAGG + Intergenic
1031966772 7:128032534-128032556 CCCGCCCTCCGGCCCGCACCCGG + Intronic
1032192329 7:129772118-129772140 CCCAGCCTCTGCCCAGCCTCAGG - Intergenic
1032197611 7:129798598-129798620 CCCACCCCCAGCCCACCTTCAGG + Intergenic
1033683712 7:143620681-143620703 CCCAGCCTGTGCCCCGCCTCCGG + Intergenic
1033700900 7:143836957-143836979 CCCAGCCTGTGCCCCGCCTCCGG - Intergenic
1033724018 7:144093625-144093647 CCCACCCCCCACCCCGCAACAGG + Intergenic
1034410420 7:150938490-150938512 CCAACCCTCAGACCTGCACCAGG + Intergenic
1034948569 7:155280767-155280789 CCCACCCCCAGCCCCATCTCTGG + Intergenic
1035737903 8:1902147-1902169 CTCACCCCCCGCCCCGCAACAGG + Intronic
1036390262 8:8318785-8318807 GGCACTCTCAGCCCCGCAGCCGG - Exonic
1037241244 8:16780694-16780716 CTCACCCTCAGACCCCCATCAGG - Intergenic
1037885014 8:22591374-22591396 CCCAGCCTCAGCCATGGATCTGG + Intronic
1039554833 8:38468195-38468217 CCCTCCCCCCGCCCCGCCTCCGG - Intronic
1039565668 8:38550920-38550942 GCCACCCACAGCTCCTCATCTGG - Intergenic
1040447215 8:47507533-47507555 CCTTCCCTCAGCCCCCCACCAGG - Intronic
1040936399 8:52786268-52786290 CCCACACTCACCCCCTCACCAGG - Intergenic
1041965562 8:63670592-63670614 CCCACCCACAGCTCCGGACCTGG - Intergenic
1042693935 8:71534745-71534767 CTCACCCCCAGCCCTGCAACAGG - Intronic
1044728880 8:95214475-95214497 CCCAGCCTCAGCTCAGCAGCTGG + Intergenic
1045252784 8:100495573-100495595 CCCACCCTAAGACCCTCACCTGG + Intergenic
1047492899 8:125388972-125388994 CCCACCAGCAGCCTCCCATCTGG + Intergenic
1048175092 8:132144812-132144834 CCAAGCATCAGCCCCACATCTGG + Intronic
1048716100 8:137272027-137272049 CCCACCCTCTGCCCCCAAGCAGG - Intergenic
1049344751 8:142132874-142132896 CCAAGCCTCTGCCCAGCATCAGG - Intergenic
1049346585 8:142142476-142142498 CCCAGCCCCAGCCCCTCAGCAGG - Intergenic
1049372887 8:142276111-142276133 CACACCCTGATCGCCGCATCTGG + Intronic
1049791229 8:144473584-144473606 CCCGCCCCCAGCCCTGCATCAGG + Exonic
1053459050 9:38254392-38254414 CCAGCCCTCAGCTCAGCATCTGG - Intergenic
1053530159 9:38873143-38873165 CCCCCCCTCCGCCCCCCACCAGG - Intergenic
1054635974 9:67490790-67490812 CCCCCCCTCCGCCCCCCACCAGG + Intergenic
1054931084 9:70635916-70635938 CCCACCCTCATCCCAGCCCCCGG - Intronic
1056901920 9:90607796-90607818 CCAACCCTCCGCCCAGCTTCAGG - Intergenic
1056925326 9:90829388-90829410 CCCACCCTCAGGCTCCCTTCTGG - Intronic
1057008388 9:91581001-91581023 CCCACCCTCAGCTCCTACTCTGG + Intronic
1057139076 9:92716017-92716039 CCCTCCCACAGCTCCGCACCCGG - Intronic
1057229221 9:93308767-93308789 CGCACCCACAGCTCCGCAGCTGG + Intronic
1057282529 9:93723135-93723157 ACCACCCTCACCCCCTCATAAGG - Intergenic
1057906800 9:98989663-98989685 ACAAGCCTCAGCCCAGCATCTGG + Intronic
1058934012 9:109750989-109751011 TCCACCCTCACCCCTGCTTCTGG + Intronic
1060220922 9:121763662-121763684 CCCACCCTCTGCCCTGCTGCTGG - Intronic
1061322427 9:129839616-129839638 CACACCCCCAGCCCCGCACAGGG - Intronic
1061727645 9:132590169-132590191 CCCAGCCTCAGCCCCGGTCCGGG + Exonic
1061727797 9:132590722-132590744 CCCACCCTCCGCCCAGCGTCCGG + Intergenic
1061985541 9:134128227-134128249 CCTACCTTCCTCCCCGCATCTGG + Intergenic
1062063686 9:134514517-134514539 CCCACCCTGAGCTCAGCACCAGG + Intergenic
1062221431 9:135418157-135418179 CCTCCCCTCAGCCCCGAAGCAGG - Intergenic
1062527379 9:136983424-136983446 CCCTCCCTCAGTTCTGCATCGGG + Exonic
1062640000 9:137514236-137514258 CCCACCCACAGCCCAGCCACAGG - Intronic
1062640062 9:137514432-137514454 CCCACCCACAGCCCAGCCACAGG - Intronic
1062640153 9:137514715-137514737 CCCACCCACAGCCCAGCCACAGG - Intronic
1186426922 X:9469773-9469795 ACCCCCCCCAGCCCCGAATCTGG + Intronic
1186463284 X:9765379-9765401 CGCGCCCTCAGCCCTGCACCGGG + Intronic
1186510321 X:10125521-10125543 CCCTCCATCAGGCCCCCATCTGG - Intronic
1187770235 X:22687503-22687525 GCCACCCTCATCCCTGCATCTGG + Intergenic
1190324407 X:49197953-49197975 CCCACCCCCACCCCCTAATCAGG + Intronic
1192148540 X:68697776-68697798 CTCTCCCTCAGCCCCACATGGGG - Intronic
1192210187 X:69123061-69123083 CCCACCCACTGCCCCACTTCAGG + Intergenic
1193615276 X:83680167-83680189 CCCTCCCCCAGCCCCCCAACAGG + Intergenic
1194635994 X:96345521-96345543 CCCACCCACCGCCCCACAACAGG + Intergenic
1196592352 X:117501085-117501107 CCCTCCCCCAGCCCCCCAACAGG - Intergenic
1197525093 X:127551440-127551462 CCCACCCTCTGCCCAGCCTCTGG + Intergenic
1198748819 X:139918544-139918566 CCCACCCCCACCCCCGCCCCGGG - Intronic
1199720678 X:150541043-150541065 CCCTCCCCCAGCCCTACATCTGG + Intergenic
1200045860 X:153400836-153400858 CCGACCCCCAGCCCCACAGCCGG + Intergenic
1200224920 X:154412001-154412023 CCCACCCTAAGTCCCACCTCCGG - Exonic
1200229236 X:154435899-154435921 CCCACCCTCAACCCCCCCACTGG - Exonic
1200238641 X:154482144-154482166 CTCACCCCCAGCCCCTCATCAGG - Intergenic
1201013762 Y:9576609-9576631 CCCTCCCTCCGCCCCACAACAGG - Intergenic