ID: 1123002160

View in Genome Browser
Species Human (GRCh38)
Location 14:105301338-105301360
Sequence GTGGAGAGACGGCCTGCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123002146_1123002160 14 Left 1123002146 14:105301301-105301323 CCGGATGCGGGGCTGAGGGTGGG 0: 1
1: 0
2: 4
3: 57
4: 395
Right 1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG 0: 1
1: 0
2: 1
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123002160 Original CRISPR GTGGAGAGACGGCCTGCGAA GGG Exonic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
902813158 1:18901146-18901168 GTGCAGGGAAGGCCTGCAAACGG + Intronic
904371936 1:30053464-30053486 GTGGGGAGACCGCCTGAGGATGG + Intergenic
911196447 1:94999896-94999918 GAGGAGAGATGGCCTGCGCCAGG - Intronic
916793476 1:168144918-168144940 GTGGAGAGAAAGCCTGCTCAGGG - Intergenic
922554981 1:226526165-226526187 GTGGAGAGAGGCCCTGGAAAAGG - Intergenic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG + Intergenic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1064624417 10:17247695-17247717 GTGGAGAAAGGGCCTGGAAAAGG - Intergenic
1068668883 10:59704413-59704435 GTTGAGAGACGTCATGCTAAAGG + Intronic
1070288722 10:75101087-75101109 GTGGGGAGAAGGCCTGCAGAAGG + Intronic
1070665248 10:78338019-78338041 CTGGAAAGACAGCCTCCGAAAGG - Intergenic
1070711219 10:78684554-78684576 GTGGAGAGATGGCCCCCTAAAGG - Intergenic
1074111623 10:110426860-110426882 GTGGAGAGACGTCATTGGAATGG + Intergenic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1080451625 11:32382969-32382991 GTGGAGAGACTGCATGTAAATGG + Intergenic
1091805348 12:3352160-3352182 GTGGAGAGAGGGTCTTCAAAAGG - Intergenic
1092968279 12:13666727-13666749 GTGGAGATACAGCCTGTGCATGG + Intronic
1093032240 12:14298776-14298798 GTGGAAAGACGGCCTGGGCCAGG + Intergenic
1095490934 12:42733133-42733155 GTGGAGAGACTGACTTCAAAGGG + Intergenic
1105041677 12:132966230-132966252 GTGGAAGGACGGCCTAAGAACGG + Intergenic
1108108717 13:47043825-47043847 GTGGAGAATCGACCTGAGAAGGG - Intergenic
1110416582 13:75260089-75260111 GTGGAGGGAGGGCATGTGAAAGG - Intergenic
1118779631 14:68998579-68998601 GTGGAGAGAAGGTATGAGAAAGG + Intergenic
1119438090 14:74611179-74611201 GTGGAGAGGCGCCTTGCGAAAGG + Intronic
1122594176 14:102877824-102877846 GTTGAGGGAGGGCCTGCGGAAGG - Intronic
1122884031 14:104702645-104702667 CTGGGGAGACGGGCTGAGAATGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1124513611 15:30348085-30348107 GTGGTGGGATGGCCTGCGAGAGG - Intergenic
1124729310 15:32182680-32182702 GTGGTGGGATGGCCTGCGAGAGG + Intergenic
1125193808 15:37023655-37023677 GTGCTGAGACTGCCTGAGAAAGG + Intronic
1129661997 15:77558091-77558113 GTGGACAGAGGGGCTGTGAATGG + Intergenic
1130840432 15:87694795-87694817 GTGGAGAGACGACCTCGGATTGG - Intergenic
1132752702 16:1466123-1466145 GTGGAGGGACCGCATGCGCAGGG + Intronic
1137416345 16:48285148-48285170 GTGGTGAGAGGACATGCGAAAGG - Intronic
1139130605 16:64138767-64138789 GTGAAGAAACTGCCTGCAAAGGG - Intergenic
1141469088 16:84226353-84226375 GTGTAGGGATGGCCTGTGAAGGG + Intronic
1144710304 17:17397353-17397375 GAGGAGAGACTGGCTGGGAAAGG + Intergenic
1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG + Intronic
1163771113 19:19192016-19192038 GTGGAGGGGCGGCCTGACAAAGG - Intronic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1165255545 19:34575549-34575571 TTGGAGAGGGGGCCTGCAAAGGG + Intergenic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
929936337 2:46297072-46297094 GGGGAGAGGCAGCCTGCGCAGGG - Intronic
936513482 2:113167286-113167308 GTGGACAGACGGCCAGGGACAGG - Intronic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
946622432 2:221573549-221573571 GAGGAGGGGCGGCCTGGGAAGGG - Intronic
1169781419 20:9314519-9314541 GTGGAGAGAATGCCAGAGAAGGG + Intronic
1172799437 20:37565680-37565702 GTGGAGAGTGGGCCTGGGCAGGG + Intergenic
1173088042 20:39943281-39943303 GTGGAGAGCTGGCCTGCGCACGG + Intergenic
1174140272 20:48408280-48408302 GTGGAGAGCCAGCCAGGGAAAGG - Intergenic
1174240463 20:49130308-49130330 GGGGAGAGACTGACTGCAAAGGG + Intronic
1174242366 20:49147502-49147524 GTGGACAGACGGGCTGCTTATGG + Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
952336184 3:32404983-32405005 GTTGAGAGAGGGCCTGTGAGGGG + Intronic
954371694 3:50172368-50172390 GTGGAGAGGGGGCTTGCCAAGGG + Intronic
958136249 3:89497275-89497297 GTGGAGTGAGGGACTGCAAAAGG - Intergenic
967073278 3:185980657-185980679 CTGGAGGGAAGGCCTGTGAAGGG + Intergenic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
993502467 5:88678734-88678756 GTGGAGAGAGGGTCTGCTGAGGG + Intergenic
997440743 5:133907150-133907172 GTGGGGAGCCTGCCTGCGCAGGG + Intergenic
999109233 5:149103457-149103479 GTGAAGAGACAACCTGCTAATGG + Intergenic
1000230649 5:159312205-159312227 GTGGGGAGACGGACTCCTAAGGG + Intergenic
1001944728 5:175769730-175769752 ATGGAGAGACGGCCTCCAAGAGG + Intergenic
1004176680 6:13346200-13346222 ATGCAGAGACGGCCTGAGATAGG - Intergenic
1004332368 6:14733554-14733576 GAGGAGAGACTGCCTTCTAATGG + Intergenic
1005397581 6:25399109-25399131 GTGGAGAGAAGGCCTCTGGAAGG + Intronic
1006747322 6:36352467-36352489 GGGGTGAGAGGGCCTGGGAAGGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1019317137 7:391951-391973 GTGCAGAGAGGCCCTGGGAAGGG - Intergenic
1019371466 7:664122-664144 GTGGAGAGAGGCCAGGCGAAGGG - Intronic
1023632823 7:42180553-42180575 GTGGAGTGATGGCCTGGAAAAGG + Intronic
1023800234 7:43827411-43827433 GGGGAGGGACGACCTCCGAATGG - Intergenic
1032068874 7:128791766-128791788 GTGGAGAGACGCGCTGGGGAGGG - Intronic
1034936660 7:155204464-155204486 GTGGAGAGGCGGCGTGCACATGG - Intergenic
1046997552 8:120541291-120541313 GTGGAGAGAGGGCCAGAGGAGGG - Intronic
1048295855 8:133212854-133212876 CTGGAGAGAGGGCCTGCGGGGGG - Exonic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1053229396 9:36393818-36393840 GTTGTGAGAAGGCATGCGAAAGG + Intronic
1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG + Intronic
1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG + Intergenic
1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG + Intergenic
1061315134 9:129790707-129790729 ATGGAAAGAAGGCCTGGGAAAGG - Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062689149 9:137832517-137832539 GTGGGGGGAGGGCCTGCGGAGGG - Intronic
1185867401 X:3636255-3636277 GTGCAGACACAGGCTGCGAAGGG + Intronic
1194391870 X:93329003-93329025 CTGGAGAGTCTGCCTGAGAATGG - Intergenic
1196741941 X:119032620-119032642 GTGGGGAGACTGGCTGGGAAGGG + Intergenic
1200796588 Y:7346437-7346459 GTGCAGACACGGGCTGCGAAGGG - Intergenic
1202358328 Y:24075251-24075273 GTGGAGAGACGGCTTTAGAGTGG - Intergenic
1202512450 Y:25594862-25594884 GTGGAGAGACGGCTTTAGAGTGG + Intergenic