ID: 1123003431

View in Genome Browser
Species Human (GRCh38)
Location 14:105309257-105309279
Sequence TCAGGATAACCACAGTCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123003430_1123003431 -6 Left 1123003430 14:105309240-105309262 CCTCTTAATCTTGGGGCTCAGGA 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1123003431 14:105309257-105309279 TCAGGATAACCACAGTCAAGAGG 0: 1
1: 0
2: 4
3: 14
4: 137
1123003428_1123003431 -5 Left 1123003428 14:105309239-105309261 CCCTCTTAATCTTGGGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1123003431 14:105309257-105309279 TCAGGATAACCACAGTCAAGAGG 0: 1
1: 0
2: 4
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123003431 Original CRISPR TCAGGATAACCACAGTCAAG AGG Exonic
901024955 1:6274262-6274284 TCAAGACAGCCACAGCCAAGAGG + Intronic
901225791 1:7612297-7612319 TCAGGATGACCAAACTCCAGGGG - Intronic
901319383 1:8330303-8330325 TCAGGGTGACCGCAGTGAAGAGG - Exonic
905262864 1:36731578-36731600 TGTGCATAACCATAGTCAAGGGG - Intergenic
907395090 1:54184105-54184127 ACATGAAAACCACAGTCAACAGG + Intronic
910375201 1:86561194-86561216 TCAGGATAATTACAGGGAAGAGG - Intronic
912207768 1:107527099-107527121 TCAGTATAACCACATACTAGGGG - Intergenic
918838733 1:189505459-189505481 TCAGGAAACTCACAGTCATGGGG - Intergenic
923263482 1:232289722-232289744 TCAGCATAACCATAGGCAAGTGG + Intergenic
924897937 1:248362405-248362427 AGAGGATGACCACAGTCAGGTGG - Exonic
924909064 1:248489329-248489351 AGAGGATGACCACAGTCAGGTGG - Exonic
924915041 1:248558729-248558751 AGAGGATGACCACAGTCAGGTGG + Exonic
1063900916 10:10731859-10731881 TCAGGATAAGCAAAGTGAGGAGG + Intergenic
1065636661 10:27742199-27742221 TCAGGAAAAGCACATTCAAAGGG + Intronic
1070002337 10:72388912-72388934 GCTGGATAACCACGATCAAGTGG + Intronic
1072711266 10:97717166-97717188 ACAGGAGAACCAAAGTCAAAGGG - Intronic
1072793962 10:98339981-98340003 TCCAGAAAACCACACTCAAGAGG + Intergenic
1073586407 10:104714912-104714934 TTAGGAAGACCAGAGTCAAGAGG + Intronic
1074297899 10:112208091-112208113 TCAGGATAACCACATGCATCAGG + Intronic
1074961231 10:118447852-118447874 TCAGGATAACCACAGGACAGGGG - Intergenic
1077071958 11:678948-678970 TCAGGATCACCACATTTCAGGGG - Intronic
1078035155 11:7796204-7796226 ACAGGGTAACCACAGTGAGGTGG + Exonic
1079257918 11:18848561-18848583 CCAGTATAACCACAGTGAAGGGG + Intergenic
1080402450 11:31948588-31948610 TCAGGTTATCCAAAGTTAAGAGG + Intronic
1081170470 11:39863675-39863697 TCAGGAGAGCCACATTCCAGAGG + Intergenic
1081342330 11:41943599-41943621 TCAGGAAACCCACTGGCAAGAGG + Intergenic
1081411487 11:42763758-42763780 TCAGGACTACCACAGTGAAATGG + Intergenic
1081607735 11:44537723-44537745 TTAGGATCACCACAGTGGAGGGG + Intergenic
1083045319 11:59729250-59729272 TCAGGAGAACCACAATGAGGTGG - Intronic
1083047428 11:59749370-59749392 GGAGGAGAACCACAGTCAGGTGG - Intronic
1094043433 12:26141833-26141855 TCAGGATATGCACAGTCTATGGG + Intronic
1096066936 12:48748538-48748560 TCATGATCACCAAACTCAAGCGG + Intergenic
1097044356 12:56176390-56176412 TCAAGATAACCACATTGATGAGG - Intronic
1098755454 12:74356799-74356821 TAAGGAAATCCAAAGTCAAGAGG + Intergenic
1099126104 12:78760149-78760171 TCACTATATCCACAGTTAAGGGG + Intergenic
1104850030 12:131868408-131868430 GCAGGATACCCACAGGCCAGCGG + Intergenic
1106313617 13:28575276-28575298 TGAGGGTATCCACAGTCAACGGG + Intergenic
1106894468 13:34283819-34283841 TCAGGTTATCTAAAGTCAAGAGG - Intergenic
1108806210 13:54159528-54159550 TCCATATATCCACAGTCAAGAGG + Intergenic
1109707167 13:66111435-66111457 TCAAGATAAGCAAATTCAAGAGG - Intergenic
1112415233 13:99199041-99199063 TCAGGAAAACGACAGTCAAAAGG - Intergenic
1114140676 14:19906404-19906426 ACAGGGTCACCACAGTCACGTGG - Intergenic
1117110123 14:52444144-52444166 TAAGGAGAAACACAGTTAAGAGG + Intronic
1117542313 14:56760249-56760271 TAAGGAGAACCACAGTAAGGGGG - Intergenic
1118255236 14:64200031-64200053 TCAAGATCACCACAGTCCTGTGG + Intronic
1121575594 14:94982895-94982917 TCAGGTTATCTAAAGTCAAGAGG + Intergenic
1123003431 14:105309257-105309279 TCAGGATAACCACAGTCAAGAGG + Exonic
1124064329 15:26325852-26325874 TCAGGATTAGCAGACTCAAGTGG - Intergenic
1124291894 15:28459478-28459500 TCAGATTAAACACAGTCAAGCGG - Intergenic
1124965811 15:34432963-34432985 TCAAAACAACCACAGGCAAGAGG + Intronic
1124982435 15:34579062-34579084 TCAAAACAACCACAGGCAAGAGG + Intronic
1126548520 15:49900883-49900905 TTTGGATCACCACAGTAAAGGGG - Intronic
1135901793 16:26466435-26466457 TCAGGTTACCCAAAGTTAAGAGG + Intergenic
1136706890 16:32198194-32198216 TCAGGTTAAACACAGTCAAGTGG + Intergenic
1136761021 16:32731223-32731245 TCAGGTTAAACACAGTCAAGTGG - Intergenic
1136807082 16:33139163-33139185 TCAGGTTAAACACAGTCAAGTGG + Intergenic
1138284023 16:55794268-55794290 TCAGGATGAGCAGAGTCCAGAGG + Intergenic
1138284979 16:55802719-55802741 TCAGGATGAGCAGAGTCCAGAGG - Intergenic
1139877947 16:70161473-70161495 TCAGGAGAAGCACAGTTGAGTGG + Exonic
1140534819 16:75700113-75700135 TCAGTATAACCAGAGTCAAAAGG - Intronic
1203063173 16_KI270728v1_random:991540-991562 TCAGGTTAAACACAGTCAAGTGG - Intergenic
1144242700 17:13328751-13328773 TCAAGATAACCAAAGGCAACAGG - Intergenic
1147061678 17:37884717-37884739 CTAGGATGACCGCAGTCAAGTGG + Intergenic
1150652793 17:67020727-67020749 TCATGATCACCACAGACAACTGG + Intronic
1153839234 18:8990948-8990970 TCATGAAACCCACAGGCAAGTGG - Intergenic
1155366360 18:25052861-25052883 AAAGGATAAGCATAGTCAAGAGG - Intergenic
1161500854 19:4614655-4614677 TCAGGATGACCAGAGTGCAGGGG + Intergenic
1164397908 19:27881921-27881943 TCAGGATGGCCACAGTCAGATGG + Intergenic
1166405489 19:42519030-42519052 TCAGCATAAACCCTGTCAAGAGG - Exonic
1167452481 19:49580269-49580291 TCACTATAAACTCAGTCAAGTGG - Intronic
1167656880 19:50770729-50770751 ACAGGATAACCACAGTCAGTGGG - Exonic
925476240 2:4219294-4219316 TCAGTATTAACACTGTCAAGAGG + Intergenic
928420030 2:31131302-31131324 CCAGGATAAATACAGGCAAGTGG + Intronic
931122744 2:59238441-59238463 TCAGATTAACAAAAGTCAAGAGG - Intergenic
932204586 2:69867768-69867790 TCATGGTTACCACATTCAAGTGG - Intronic
933471759 2:82735091-82735113 TCAAGATAACCACTGTTTAGAGG + Intergenic
936280700 2:111137261-111137283 GCAGGATGACCACAGACATGAGG - Intronic
939425796 2:142034784-142034806 TCATGATAACCACAGTGTGGTGG - Intronic
943654419 2:190492345-190492367 TCAGGCTATCTAAAGTCAAGAGG + Intronic
945377226 2:209093357-209093379 TCAGGATATCTAAAGTCAAGAGG - Intergenic
947451828 2:230215764-230215786 TCAGGGTAGGCACTGTCAAGTGG + Intronic
1169336034 20:4758268-4758290 TCAGGTTATCCAAAGTCAAGAGG - Intergenic
1169656820 20:7933469-7933491 TCAGGATTACCATAGACAAAAGG + Intronic
1170329370 20:15191422-15191444 TCACTATAACTGCAGTCAAGAGG - Intronic
1171336051 20:24386521-24386543 TCAGGACAACAACATTCATGAGG - Intergenic
1171415969 20:24980613-24980635 GCAGGGCCACCACAGTCAAGAGG + Intronic
1178782989 21:35623871-35623893 CCAGGATGACCACAGTGGAGGGG - Intronic
1180720696 22:17906163-17906185 TAAGAACAACCAAAGTCAAGTGG - Intronic
954853545 3:53623790-53623812 TCAGGATGATCACAGTCAAAAGG - Intronic
955500604 3:59578986-59579008 TCAGGTTAACAACAGTCATGAGG - Intergenic
956883365 3:73533847-73533869 TCAGGCTAACCTCACTGAAGAGG - Intronic
958095452 3:88938666-88938688 TCAGGATAATTACAATCATGGGG + Intergenic
958187705 3:90144488-90144510 GCAGGAAAACCACAGGAAAGGGG + Intergenic
961919532 3:130411472-130411494 TCAAGATAAACAAAGGCAAGTGG - Intronic
962251868 3:133840627-133840649 TCAGGGTAACCACAGCCCTGAGG + Intronic
962361532 3:134747379-134747401 TCAGGGAAACCACTGCCAAGTGG + Intronic
962366568 3:134789961-134789983 TCAGGTAAAAAACAGTCAAGAGG - Intronic
965048593 3:163613287-163613309 TCAGGATAACAACAGTAGAAAGG - Intergenic
965567029 3:170130705-170130727 TAAGAATTAGCACAGTCAAGTGG + Intronic
971972585 4:33638913-33638935 TCAGGATACTTACAGTCATGGGG - Intergenic
975222119 4:71824691-71824713 TTGGGATAAACACAGTTAAGGGG - Intergenic
976045387 4:80940475-80940497 TGAGGATAAACACACTGAAGTGG - Intronic
977452885 4:97221655-97221677 CCAGGATAACCATTGGCAAGTGG + Intronic
977680035 4:99788241-99788263 ACAGGGTGACCACAGTCAACAGG - Intergenic
978199674 4:106011238-106011260 TCAGGTTATCCAAAGTCAAGAGG - Intergenic
980244869 4:130225847-130225869 TCAGGATAACCACAGTAGTGTGG + Intergenic
982206029 4:152997761-152997783 TCAGGACACCCACTCTCAAGCGG + Intergenic
986198046 5:5556041-5556063 TCAGGGTAACCACTGACATGTGG - Intergenic
986328738 5:6702060-6702082 TCAGGATGTCCAGAATCAAGAGG - Intergenic
989355328 5:40538100-40538122 TCAGGTTATCTAAAGTCAAGAGG - Intergenic
990376624 5:55176766-55176788 TTAGGATAACCGCACTCAGGTGG + Intergenic
991661234 5:68952792-68952814 TCAGGAAGTCCAGAGTCAAGTGG + Intergenic
992946808 5:81819214-81819236 TCAGGAAGACCACAGTGAAAGGG + Intergenic
993964916 5:94348343-94348365 TCAGGTTATCCAAAGTTAAGAGG + Intronic
996213950 5:120845007-120845029 ACAAGATAATCACATTCAAGGGG + Intergenic
997696132 5:135862540-135862562 TCAGGGTGTCCACAGTCTAGTGG + Intronic
999121348 5:149211917-149211939 TCATGGTAACCACAACCAAGTGG + Intronic
999812937 5:155145050-155145072 TTAGGATAGCCCCAGTCAAAAGG + Intergenic
1000264645 5:159623016-159623038 TCAGGTTATCTAAAGTCAAGAGG + Intergenic
1000323975 5:160158083-160158105 TCAGGATGTTCACAGTCTAGTGG + Intergenic
1006167505 6:32073650-32073672 TCACGATGACCACAGACAGGGGG + Intronic
1012071448 6:94623665-94623687 TCAGAATTAACACAGACAAGAGG - Intergenic
1015194806 6:130514019-130514041 TCAGAAAAACCACAGGCTAGGGG - Intergenic
1016306973 6:142694944-142694966 TCAGGCTCACCAAAGCCAAGTGG + Intergenic
1019849646 7:3541645-3541667 TTAGGATATACACAGTCATGTGG - Intronic
1024330660 7:48151581-48151603 TGAGGAGAACCACAGAGAAGTGG - Intergenic
1027453220 7:78356801-78356823 TGAGGATACCAAGAGTCAAGTGG - Intronic
1028261831 7:88675478-88675500 TCAGGTTATCTAAAGTCAAGAGG + Intergenic
1028425192 7:90678457-90678479 TCAGGACATCCACAGTCTAGTGG - Intronic
1029247473 7:99212973-99212995 CCAGAATAACCAATGTCAAGAGG + Intergenic
1031800597 7:126239416-126239438 TCAGCATATCCACAGTAAACAGG - Intergenic
1032325307 7:130922581-130922603 TCAGGAAAACCACAGGCTGGAGG + Intergenic
1038427401 8:27472878-27472900 TCACTGTCACCACAGTCAAGAGG - Intronic
1039241405 8:35560892-35560914 TCAGGCTAACCACAGTTGGGAGG - Intronic
1041779168 8:61558601-61558623 TCAGGAAAAACACTGTCAGGAGG + Intronic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1043736482 8:83752807-83752829 TCAGGAAAACTACAGTGCAGAGG - Intergenic
1045019373 8:98028397-98028419 TCAGGAAAACCTCAGAGAAGAGG - Intronic
1051273369 9:15376126-15376148 TCAGGTTATCTAAAGTCAAGAGG + Intergenic
1051732259 9:20156946-20156968 TCAGGATAACCACTCTTAATTGG - Intergenic
1051932446 9:22402546-22402568 TCAGGAAACTCACAGTCCAGTGG + Intergenic
1052740328 9:32386115-32386137 TCAGGATTACAACAGTGATGTGG + Intronic
1055720773 9:79171704-79171726 TCTGTATAACCACAGTCATCTGG - Intergenic
1055748894 9:79482398-79482420 ACTGGATAAGTACAGTCAAGTGG + Intergenic
1056769920 9:89470042-89470064 TGAGGTTAAGCAAAGTCAAGAGG + Intronic
1057528406 9:95822858-95822880 TCAAGATGACCACAGTCAGATGG - Intergenic
1057832954 9:98420565-98420587 TCAGGAAGCCCACAGTCTAGTGG + Intronic
1059157714 9:112004687-112004709 TCAGGATAAGCCCAGGGAAGAGG - Intergenic
1185616797 X:1426859-1426881 TCAGGAGGACCACAGTTAGGAGG + Intronic
1186581481 X:10824572-10824594 TCAGCAAAGCCACAGCCAAGTGG + Intronic
1188545506 X:31301467-31301489 GCAGGATAGACACAGTGAAGGGG + Intronic
1189469687 X:41304020-41304042 ACTGGAGAACCACAGTCACGGGG - Intergenic
1193292778 X:79795638-79795660 TCAGGAGCACAACAATCAAGGGG - Intergenic
1197903460 X:131398225-131398247 ACAGGCTAACAGCAGTCAAGTGG + Intronic
1199333235 X:146586494-146586516 TCAGGAGAACAACACTAAAGGGG - Intergenic
1199926477 X:152471564-152471586 TCAGGTTATCCAAAGTTAAGAGG + Intergenic