ID: 1123004570

View in Genome Browser
Species Human (GRCh38)
Location 14:105315049-105315071
Sequence CCGCCGCGCTTTGTTCCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123004566_1123004570 -8 Left 1123004566 14:105315034-105315056 CCAGGTACGCGCCGCCCGCCGCG 0: 1
1: 1
2: 0
3: 22
4: 158
Right 1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1123004564_1123004570 4 Left 1123004564 14:105315022-105315044 CCAGCTGCGTGCCCAGGTACGCG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1123004563_1123004570 5 Left 1123004563 14:105315021-105315043 CCCAGCTGCGTGCCCAGGTACGC 0: 1
1: 0
2: 1
3: 5
4: 59
Right 1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1123004565_1123004570 -7 Left 1123004565 14:105315033-105315055 CCCAGGTACGCGCCGCCCGCCGC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1123004562_1123004570 6 Left 1123004562 14:105315020-105315042 CCCCAGCTGCGTGCCCAGGTACG 0: 1
1: 0
2: 2
3: 10
4: 202
Right 1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1123004560_1123004570 10 Left 1123004560 14:105315016-105315038 CCAGCCCCAGCTGCGTGCCCAGG 0: 1
1: 0
2: 6
3: 59
4: 614
Right 1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1123004559_1123004570 28 Left 1123004559 14:105314998-105315020 CCTGGGAGGTGGACGGCTCCAGC 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1123004570 14:105315049-105315071 CCGCCGCGCTTTGTTCCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123004570 Original CRISPR CCGCCGCGCTTTGTTCCCGC CGG Exonic