ID: 1123004935

View in Genome Browser
Species Human (GRCh38)
Location 14:105316587-105316609
Sequence CACACGCCCCCACCTCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123004935_1123004945 -6 Left 1123004935 14:105316587-105316609 CCCAAGGGAGGTGGGGGCGTGTG 0: 1
1: 0
2: 1
3: 11
4: 255
Right 1123004945 14:105316604-105316626 CGTGTGGCAGGAGGGGCCGGGGG 0: 1
1: 1
2: 4
3: 36
4: 477
1123004935_1123004943 -8 Left 1123004935 14:105316587-105316609 CCCAAGGGAGGTGGGGGCGTGTG 0: 1
1: 0
2: 1
3: 11
4: 255
Right 1123004943 14:105316602-105316624 GGCGTGTGGCAGGAGGGGCCGGG 0: 1
1: 1
2: 3
3: 75
4: 712
1123004935_1123004944 -7 Left 1123004935 14:105316587-105316609 CCCAAGGGAGGTGGGGGCGTGTG 0: 1
1: 0
2: 1
3: 11
4: 255
Right 1123004944 14:105316603-105316625 GCGTGTGGCAGGAGGGGCCGGGG 0: 1
1: 0
2: 3
3: 40
4: 492
1123004935_1123004947 14 Left 1123004935 14:105316587-105316609 CCCAAGGGAGGTGGGGGCGTGTG 0: 1
1: 0
2: 1
3: 11
4: 255
Right 1123004947 14:105316624-105316646 GGGCCTTATCAGCCCCCCTGTGG 0: 1
1: 0
2: 1
3: 66
4: 333
1123004935_1123004942 -9 Left 1123004935 14:105316587-105316609 CCCAAGGGAGGTGGGGGCGTGTG 0: 1
1: 0
2: 1
3: 11
4: 255
Right 1123004942 14:105316601-105316623 GGGCGTGTGGCAGGAGGGGCCGG 0: 1
1: 1
2: 6
3: 116
4: 1427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123004935 Original CRISPR CACACGCCCCCACCTCCCTT GGG (reversed) Intronic
900624206 1:3600761-3600783 CACATGTCACCACCTCACTTGGG + Intronic
900658093 1:3770067-3770089 GCCATGCCCCCACCTGCCTTAGG - Intronic
901320714 1:8338365-8338387 CCCCTGCCCCCACCTCCCTGGGG - Intronic
901540175 1:9910362-9910384 CCCACGCGCCCGCCTCCCTCCGG - Intergenic
903141468 1:21341747-21341769 CACATGCCCCCACGTCACTCTGG - Intronic
903416606 1:23187726-23187748 CCCACGCCCTCAGCTCCCTCAGG - Intergenic
903458441 1:23504372-23504394 CTGACCCCCCCACCTCCCTCCGG - Intergenic
903685230 1:25126732-25126754 CACAAGTCCCAGCCTCCCTTGGG - Intergenic
904857286 1:33509280-33509302 CCCCCCCCCCCACCTCCCTCCGG + Intergenic
905268967 1:36774250-36774272 CGCTCACCCCCACCTCCCCTTGG + Intergenic
905672434 1:39800674-39800696 CCCATGCCCACACCTGCCTTGGG - Intergenic
907140661 1:52182083-52182105 CTGACCCCCCCACCTCCCTCCGG - Intronic
907324180 1:53626156-53626178 TACAAGCCCACACCTCTCTTTGG + Intronic
907498618 1:54861949-54861971 CACACCCTCCCACCACCCTATGG + Intronic
912811982 1:112801807-112801829 CACAAGCCCCCTCCTCCCCAGGG - Intergenic
915105636 1:153533651-153533673 CTCACCTCCCCACTTCCCTTGGG - Intergenic
915310508 1:155003880-155003902 CTCCCGCCCCCACCTCGCTCTGG - Intronic
915335076 1:155136263-155136285 CCCACCCCCACCCCTCCCTTCGG + Intronic
915335124 1:155136413-155136435 GCCCCGCCCCCACCTCCCTCTGG - Intronic
917494769 1:175530333-175530355 CACACACACCCGCCTCTCTTTGG + Intronic
917834707 1:178932113-178932135 GCCACGCCCTCAGCTCCCTTGGG + Intergenic
920116959 1:203628288-203628310 TACACTCCTCCACCTCCCTGAGG + Intronic
920176105 1:204102943-204102965 CACACCCACCCACCTGCCTCCGG + Intronic
920963467 1:210683759-210683781 CAATCGCCCCCGCCCCCCTTGGG + Exonic
921887534 1:220321715-220321737 CCATCGCCCCCACCTCCTTTGGG - Intergenic
922153045 1:223021368-223021390 CACACGCCCCCACCCACATCAGG + Intergenic
922422930 1:225471564-225471586 CACTCGTTCCCACCTCCCTCAGG - Intergenic
922423635 1:225475264-225475286 CACACTCTCCCCGCTCCCTTGGG + Intergenic
923490468 1:234479136-234479158 CACACGCCGGCGCCTTCCTTTGG - Intergenic
1065186267 10:23173617-23173639 CACACGCCCCCACCCCCGTCCGG + Intergenic
1065288816 10:24210076-24210098 CACCCGCCCCACCCTCCCTCAGG + Intronic
1070318084 10:75333635-75333657 CTGACCCCCCCACCTCCCTCCGG + Intergenic
1070507317 10:77125482-77125504 CATACTCCCTCACCTCCTTTGGG + Intronic
1072117185 10:92376489-92376511 CCGACCCCCCCACCTCCCTCCGG - Intergenic
1074863837 10:117533652-117533674 CCCACGCGCCCACGTGCCTTTGG + Intergenic
1075648110 10:124109658-124109680 CACCCACCCCCAACTCCCTGGGG - Intergenic
1076049785 10:127323292-127323314 CACACACCAGCACCACCCTTAGG - Intronic
1076342848 10:129761426-129761448 CACCCTCCCCCACCAGCCTTTGG + Intronic
1077065232 11:638103-638125 CACACACCCTCCCCTCCCCTGGG - Intronic
1078722509 11:13897664-13897686 CACTCTCTCCCTCCTCCCTTTGG + Intergenic
1079422243 11:20304354-20304376 ACCATACCCCCACCTCCCTTAGG - Intergenic
1079544010 11:21610944-21610966 AACACTTTCCCACCTCCCTTTGG - Intergenic
1079922440 11:26449516-26449538 CACACGCACGCACATCTCTTTGG + Intronic
1084616060 11:70236670-70236692 CACGCGCCCCCACCTCCTCCAGG + Intergenic
1084889993 11:72232082-72232104 CACACACCCACACCTTCCCTGGG - Intronic
1085059310 11:73430304-73430326 CACACACCCACACACCCCTTGGG - Intronic
1085127450 11:74011318-74011340 CCCAGGGCCCCACTTCCCTTGGG - Intergenic
1085513127 11:77098327-77098349 CTGACCCCCCCACCTCCCTCCGG + Intronic
1085633982 11:78143807-78143829 CACACGCCCACACCACCCTTAGG + Intergenic
1088548801 11:110989312-110989334 TACAGGACCCCACCTCCCTTTGG + Intergenic
1089051375 11:115548906-115548928 CACACTCCCCCTCCTTCCTCTGG - Intergenic
1089264730 11:117251253-117251275 CTGACCCCCCCACCTCCCTCCGG + Intronic
1089848724 11:121479205-121479227 CTCCCGCCTCCACCTCCCTGGGG - Intronic
1090466779 11:126942078-126942100 CACCTGCCCCCACCTTTCTTTGG - Intronic
1090858073 11:130628776-130628798 CCCATGCCCCCACCTTCCTGTGG - Intergenic
1091528688 12:1333100-1333122 CTCACCCCCCCTCCTCCATTAGG + Intronic
1092505283 12:9092405-9092427 TACCCGCCCCCACCACCCCTTGG + Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096292004 12:50351363-50351385 CACAGGCCCCTCCCTCCCCTGGG - Exonic
1096466298 12:51848952-51848974 GCCCCGCCCCCACCTCCCCTGGG + Intergenic
1102228735 12:111247804-111247826 CACACACCCTCACAACCCTTTGG + Intronic
1102465380 12:113127926-113127948 CACCTGCCCCCACTTCTCTTGGG - Intronic
1102632794 12:114296473-114296495 CACAAGACCCCACTTCCCCTGGG + Intergenic
1103126527 12:118427555-118427577 CACCTGCTCCCACCTCTCTTTGG + Intergenic
1103325263 12:120116412-120116434 CCCGCGCCCCAACCTCCCCTCGG + Intronic
1103856284 12:123973008-123973030 CCCGCGCCCCCCCCTCCCTCGGG - Intronic
1105367858 13:19779544-19779566 CTGACCCCCCCACCTCCCTCCGG - Intronic
1105951069 13:25229898-25229920 CACACCCCCTCACCTCACTCGGG - Intergenic
1106560030 13:30839426-30839448 CTGACCCCCCCACCTCCCTCCGG + Intergenic
1107106093 13:36644375-36644397 CCCACCCTCCCACCTCCCCTGGG + Intergenic
1109182338 13:59228805-59228827 CACACACGCACACCTCCCCTTGG - Intergenic
1112505449 13:99971962-99971984 CACACGTCCCCGCCTCCCCGGGG + Intergenic
1114270549 14:21098057-21098079 CACCTGGCCCCCCCTCCCTTGGG + Intronic
1117304849 14:54463239-54463261 CTCCCGCTCCCACCTCCCATTGG + Intergenic
1117450635 14:55846145-55846167 CTCACGCCCACACATCCCTTTGG + Intergenic
1120309847 14:82814426-82814448 CTGACCCCCCCACCTCCCTCCGG + Intergenic
1121660568 14:95632284-95632306 CACAGGCACCCACCTGCCCTGGG + Intergenic
1122465362 14:101929938-101929960 CCCACTCCCCCTCCTGCCTTGGG - Intergenic
1122748004 14:103911045-103911067 CATCCGTCCTCACCTCCCTTTGG + Intergenic
1122941370 14:104982921-104982943 CACACGCCCCAACTTGCCCTAGG + Intergenic
1123004935 14:105316587-105316609 CACACGCCCCCACCTCCCTTGGG - Intronic
1123701461 15:22917605-22917627 CTCACGCTCCCAACTCACTTGGG + Intronic
1123966987 15:25468991-25469013 CAGATGCTCCCACCTCCCTCAGG - Intergenic
1126894757 15:53246256-53246278 CACACACACACACCACCCTTTGG + Intergenic
1127295305 15:57604060-57604082 CACAGGCACCCACCACCCTGGGG - Intronic
1128222564 15:65979507-65979529 CACAGTCCACCACCTCCCCTGGG - Intronic
1128970233 15:72100957-72100979 CTGACCCCCCCACCTCCCTCCGG - Intronic
1129224694 15:74162146-74162168 CATAACCCCCCACCTCCCTGGGG - Intergenic
1129964995 15:79726725-79726747 CACACCTCCCTCCCTCCCTTTGG + Intergenic
1130392713 15:83473217-83473239 CCCACCCCCCCACCCACCTTTGG - Intronic
1130742321 15:86613953-86613975 CACATTACCCCACCTCCCTTAGG - Intronic
1132062994 15:98707990-98708012 CACAGGTCCCCACATTCCTTTGG - Exonic
1132988282 16:2779317-2779339 CACACTCCCCAACCTCCCAAGGG - Intergenic
1134274751 16:12766146-12766168 CACCCGCCTCTGCCTCCCTTTGG - Intronic
1134291083 16:12903037-12903059 CACACGCCCCCCTCCCCTTTCGG - Intronic
1134643961 16:15851618-15851640 CACATCCCCCCACCTCCCAAGGG + Intronic
1134667958 16:16033191-16033213 CACTCCCCACCACCTCCCTGAGG - Intronic
1135094884 16:19556404-19556426 CACACGCCACGCCCTCCCTATGG - Intronic
1136114126 16:28083936-28083958 CTCACAGCCTCACCTCCCTTGGG - Intergenic
1136186183 16:28590291-28590313 CACAGGCCCCCACCCCTCTGTGG + Exonic
1136318016 16:29465524-29465546 CACAGGCCCCCACCCCTCTGTGG - Exonic
1136401958 16:30024114-30024136 CACCCACCACCACCTTCCTTGGG + Intronic
1136426007 16:30169464-30169486 CTGACCCCCCCACCTCCCTCCGG - Intergenic
1136432591 16:30204873-30204895 CACAGGCCCCCACCCCTCTGTGG - Exonic
1137670545 16:50275883-50275905 CACCCCCGCCCACCACCCTTGGG + Intronic
1139510576 16:67426113-67426135 CACAGGCTTCCACCTGCCTTGGG + Intergenic
1141132422 16:81445120-81445142 CACACCCCCCCACCTTCCCGGGG + Intergenic
1141802445 16:86320032-86320054 CACCCGCCCCCTCCCACCTTCGG + Intergenic
1142288978 16:89184089-89184111 GACTCGCTCCCACCTCCCTGGGG + Intronic
1142308160 16:89297105-89297127 CACACACCTCCACGTCCCTGGGG - Intronic
1143322904 17:6079622-6079644 CACAAGCCCCTCCCTCCCCTGGG + Intronic
1144853182 17:18254315-18254337 CACACCCCGCAACCACCCTTGGG - Intronic
1144957700 17:19027519-19027541 CACACACCCCTACCTCTCCTGGG + Intronic
1144977457 17:19147001-19147023 CACACACCCCTACCTCTCCTGGG - Intronic
1145871368 17:28276354-28276376 AACAGGCCTCCACCTCCCTCAGG + Intergenic
1147705214 17:42421478-42421500 CACACGATCCCGCCTCCCTGGGG + Intronic
1147809635 17:43159318-43159340 CTGACCCCCCCACCTCCCTCCGG + Intergenic
1148113284 17:45159823-45159845 CACCCGCCTCCACCTCCCAAAGG + Intergenic
1148632885 17:49125737-49125759 CTGACCCCCCCACCTCCCTCCGG - Intergenic
1148818638 17:50347449-50347471 CCCCCGCCCCCACCTCCTTTTGG - Intronic
1149456251 17:56791087-56791109 TACACCACCCAACCTCCCTTGGG + Intergenic
1150346079 17:64405750-64405772 CAGACGACCCCACCGCCCCTGGG - Intronic
1151437559 17:74107452-74107474 CACCCACCCCCACCTCCAGTTGG + Intergenic
1151652929 17:75481228-75481250 CCAACGCACCCACCTCCCTTTGG - Intronic
1152288063 17:79423874-79423896 CACATGCCCTCAGCTCCCTGAGG + Intronic
1156383284 18:36583298-36583320 CACACGCCTGCACCATCCTTGGG + Intronic
1157310814 18:46551746-46551768 CACACAGCCTCACATCCCTTTGG - Intronic
1157529226 18:48408137-48408159 CACCCACCCCCAGCTCCCCTCGG + Intronic
1159185277 18:64963570-64963592 CACACACACACACCTCCCTAAGG + Intergenic
1160697431 19:491793-491815 CCCAAGCCCCCCCCTCCCCTGGG + Intronic
1160697514 19:491992-492014 CCCAAGCCCCCCCCTCCCCTGGG + Intronic
1161130923 19:2588212-2588234 CTCACGCCCCCACCAAGCTTAGG - Intronic
1161801333 19:6418126-6418148 CACACCCCCCCACCTCCTCGGGG + Intronic
1162378211 19:10317276-10317298 CAGACTCCCCCACACCCCTTGGG + Exonic
1162853517 19:13450356-13450378 CTCACTCACTCACCTCCCTTAGG + Intronic
1163392061 19:17036975-17036997 CACACCCGCCCACCTCACCTAGG + Intergenic
1163987030 19:20963046-20963068 AACATGCCTCCACCTCCCTCAGG - Intergenic
1164485632 19:28653488-28653510 CACACCCCAGCACCTCCCTCAGG + Intergenic
1164534846 19:29077663-29077685 CACCTGCCCACACCACCCTTGGG + Intergenic
1166109550 19:40613834-40613856 CACACCCCTCCACCGCCCCTCGG - Intronic
1166793733 19:45413827-45413849 CACAGGCCCTCATCTCCCCTGGG - Intronic
1167203684 19:48085789-48085811 CACACGCCCCCACCACACCAGGG + Intronic
1167253609 19:48414652-48414674 CCCCAGCCCCCTCCTCCCTTGGG + Intronic
1167350937 19:48974288-48974310 CACAAGCCCCCTGCTCCCTGTGG - Exonic
1167476110 19:49701741-49701763 CACACGCCCCCAGCCCCCAAGGG + Intronic
1167823667 19:51952836-51952858 CTGACCCCCCCACCTCCCTAAGG - Intergenic
1167897496 19:52593536-52593558 CTGACCCCCCCACCTCCCTCCGG + Intergenic
925649841 2:6078219-6078241 CACAAGCCCTTCCCTCCCTTAGG + Intergenic
927768568 2:25837073-25837095 CCCCCCCCCCCACCCCCCTTTGG - Intronic
929401503 2:41587526-41587548 CCCTCACCCCCACCTCCTTTTGG + Intergenic
929739622 2:44588463-44588485 CTGACCCCCCCACCTCCCTCCGG - Intronic
930612867 2:53562753-53562775 CCCACCTCCCCACCTCCCTCTGG - Intronic
932017273 2:68043939-68043961 CACACACACCAACCTGCCTTGGG + Intronic
933727165 2:85433549-85433571 CACACACCCCTCCCTACCTTAGG + Intronic
933949168 2:87313610-87313632 AGCACGCCCCCACCTCCCCATGG - Intergenic
934651516 2:96093789-96093811 CAAAGGCCCCCTCCTCCCTGTGG - Intergenic
935432478 2:102990944-102990966 CAAATGTCCCCTCCTCCCTTGGG - Intergenic
936009506 2:108916508-108916530 CACAGGCGCCCACCTGCCCTCGG + Intronic
936331029 2:111547987-111548009 AGCACGCCCCCACCTCCCCATGG + Intergenic
936974259 2:118203574-118203596 CACACCACCCCACCTCCCAACGG + Intergenic
943126436 2:183798472-183798494 ACCACCCCCCCACCTCCTTTTGG + Intergenic
944110700 2:196128793-196128815 AACTCGCCCCCACCTGCTTTGGG - Intergenic
944476316 2:200110409-200110431 CAGAGGCCCCTACCTCCCTCTGG + Intergenic
948422938 2:237871595-237871617 CCCCCGACCCCAACTCCCTTGGG + Intronic
948884422 2:240875672-240875694 CACGTGCCACCACCTCCCTGCGG - Intronic
1168940921 20:1710713-1710735 CACCTGCCCCAACCTCCCTGTGG - Intergenic
1169197064 20:3689033-3689055 CACTCTCCCCAACCTCCCCTTGG + Intronic
1170815384 20:19709332-19709354 CACATCCCCCCATCTCCCTGAGG - Intronic
1171265473 20:23768361-23768383 CACACACTACCACCTCTCTTCGG + Intergenic
1172051474 20:32122029-32122051 CTGACCCCCCCACCTCCCTCCGG + Intronic
1173588794 20:44208113-44208135 CCCCCGCCCCCACCCCTCTTGGG + Intronic
1173880859 20:46411178-46411200 CACACGCCCCCCCCCCCCCCCGG - Intronic
1175082637 20:56433842-56433864 CACATGCCCCTAACTCCTTTGGG + Intronic
1175297479 20:57919104-57919126 CATACCCCCTCACATCCCTTTGG + Intergenic
1175991739 20:62793293-62793315 CACACGCCCCCTCCTTTCTGAGG - Intergenic
1176044544 20:63085552-63085574 CACCCGCTTCCACCGCCCTTGGG + Intergenic
1177077023 21:16588682-16588704 CACACGCCACCCCCTCCCCTCGG - Intergenic
1179995038 21:44970364-44970386 CAGTTGCCCCCAGCTCCCTTTGG + Intronic
1180887626 22:19258485-19258507 AGCAGGCCTCCACCTCCCTTAGG - Intronic
1181776830 22:25166003-25166025 CACAGCCCCCCACGTCCCTCCGG - Intronic
1182331428 22:29553817-29553839 ACCACGCCACCACCTCCCTCGGG - Intronic
1182466553 22:30520444-30520466 CCCAGGCCTCCCCCTCCCTTTGG + Intergenic
1183741973 22:39673909-39673931 CACACGTCCCCACCGGCCTGGGG + Intronic
1183984341 22:41561364-41561386 CACACGGCCTCACCTCATTTGGG - Intronic
1184596521 22:45517375-45517397 CACCCGGCCGCTCCTCCCTTGGG + Intronic
1184864279 22:47193712-47193734 GACACGGCCCCTCCTCCCTAGGG - Intergenic
1185231482 22:49686639-49686661 CCCAGGCCCCCTCCTGCCTTGGG + Intergenic
950544705 3:13631473-13631495 CACACGCCCCCGCCTCCATCAGG + Intronic
952255101 3:31688197-31688219 ATAACGCCCCCACCTCCCTCTGG + Intronic
954335219 3:49912338-49912360 AACACACCCCCACCTGCCTCAGG + Intronic
955044231 3:55344682-55344704 CACTTGCTCCTACCTCCCTTGGG + Intergenic
955674487 3:61434774-61434796 CTGACCCCCCCACCTCCCTCCGG + Intergenic
960490139 3:118307561-118307583 CACCAGGCCCCACCTCCATTGGG - Intergenic
960921132 3:122747746-122747768 CTGACCCCCCCACCTCCCTCCGG - Intronic
961073963 3:123964241-123964263 CCCTCACCACCACCTCCCTTAGG - Intergenic
961309657 3:125987888-125987910 CCCTCACCACCACCTCCCTTAGG + Intergenic
961858091 3:129893164-129893186 CACACGCCCCTCCCTCACCTCGG + Intronic
962063296 3:131952606-131952628 CTGACCCCCCCACCTCCCTCCGG - Intronic
962198123 3:133380505-133380527 CACCCACCACCACCTCCCTGGGG + Exonic
963746320 3:149128211-149128233 CACATGCCCCACCTTCCCTTGGG + Intergenic
964741126 3:159967190-159967212 CTCACTCCCTCACCTCCTTTAGG + Intergenic
968316782 3:197731799-197731821 CTGACCCCCCCACCTCCCTCCGG + Intronic
968809055 4:2792076-2792098 CACCCACCCCCAGCTCCCTTGGG + Intergenic
969249068 4:5955335-5955357 CACACACCCCCGCCTGGCTTTGG - Intronic
971163801 4:24161440-24161462 CACACAGCCCCACATCCCATAGG - Intergenic
975101404 4:70517630-70517652 AACAGACCTCCACCTCCCTTTGG + Intergenic
975132363 4:70842116-70842138 CAGCAGCCCTCACCTCCCTTTGG + Intergenic
976699695 4:87956337-87956359 CACAGCAACCCACCTCCCTTCGG + Intergenic
979659350 4:123236067-123236089 TAAATGCCCCCACCTCCTTTGGG + Intronic
988503007 5:31799169-31799191 CACAGGGCCCCACGTCCCCTGGG - Exonic
989111745 5:37913359-37913381 CAAACGCCCCCTCCTCCGTGAGG - Intergenic
989609738 5:43279512-43279534 CAAATGCAACCACCTCCCTTCGG + Intronic
989640239 5:43577110-43577132 CACACACCCCCACCAGCCTCAGG - Intergenic
991672560 5:69062894-69062916 CTGACCCCCCCACCTCCCTCCGG + Intergenic
991672584 5:69062943-69062965 CTGACCCCCCCACCTCCCTCCGG + Intergenic
992171304 5:74104588-74104610 CACACACACACACCTTCCTTTGG + Intergenic
994094903 5:95839664-95839686 CAACGGCCCTCACCTCCCTTTGG + Intergenic
994134114 5:96265251-96265273 CACACACGCACACCTCCTTTTGG - Intergenic
996108181 5:119531559-119531581 CACACACACACACCCCCCTTTGG - Intronic
1002158655 5:177302358-177302380 CACACACCCCCACCCCCCAAAGG + Intronic
1003202329 6:3973327-3973349 CACCCGCCTCCACCTCCCACAGG - Intergenic
1004843514 6:19613701-19613723 AACAGGCCTCCACCTCCCTCAGG - Intergenic
1010863106 6:80937769-80937791 CACACTTCCCCACCTGCCATGGG - Intergenic
1013599111 6:111687588-111687610 CACACCCACCCACCCCACTTTGG - Intronic
1018677002 6:166230932-166230954 CACACACCACCACCACCATTCGG + Intergenic
1019542976 7:1559781-1559803 CACATGCCCCCTCCTCACTGGGG + Intronic
1022005537 7:26262385-26262407 CTGACCCCCCCACCTCCCTCCGG - Intergenic
1024258368 7:47556519-47556541 CAGAGGGCCCCACATCCCTTAGG + Intronic
1024979780 7:55147365-55147387 CACACTCACCCAGCTCCCCTGGG + Intronic
1025198123 7:56947480-56947502 CGCTCGCCCCCACCTCTCCTGGG + Intergenic
1025673826 7:63629457-63629479 CGCTCGCCCCCACCTCTCCTGGG - Intergenic
1025808384 7:64856581-64856603 CTGACCCCCCCACCTCCCTCCGG - Intergenic
1026584641 7:71646408-71646430 CACAGGCCACCACCTTCCTCTGG + Intronic
1027373930 7:77533977-77533999 CTGACCCCCCCACCTCCCTCCGG + Intergenic
1029569249 7:101359345-101359367 CTGACCCCCCCACCTCCCTCCGG + Intergenic
1032291263 7:130591429-130591451 CTGACCCCCCCACCTCCCTCCGG - Intronic
1034066964 7:148146307-148146329 CACACGTCTTCAGCTCCCTTAGG - Intronic
1034417769 7:150974290-150974312 CACAGGCCCCTATCTACCTTAGG - Intronic
1034460634 7:151196123-151196145 CACACCCCCCCACCATCCTCAGG - Intronic
1036660769 8:10707020-10707042 CACGGGCTCCCACCTCCCATTGG - Intronic
1037616502 8:20523896-20523918 CACACACCTCCTCCTCCCTTGGG - Intergenic
1037750040 8:21675627-21675649 CACACACACCCCCCTCCGTTTGG - Intergenic
1037990176 8:23316325-23316347 CACACGCAGCCATCTCCATTGGG - Intronic
1038156757 8:24998725-24998747 CACACACCCCTACACCCCTTTGG - Intergenic
1038718978 8:30016217-30016239 CCCACGCCCACAGCTTCCTTTGG - Intergenic
1040300192 8:46183970-46183992 CACCCGCCCACACCACCATTTGG + Intergenic
1040580644 8:48696157-48696179 CCCACGCCCTCCCCTCCCTGTGG + Intergenic
1048301802 8:133256759-133256781 GACAGGCCCCCACCTCACCTTGG + Exonic
1049583719 8:143423659-143423681 CACAGGGGCCCACCTCCCTAAGG - Intronic
1049912765 9:285466-285488 CACCACCCCCAACCTCCCTTGGG + Intronic
1060249090 9:121971203-121971225 CTGACCCCCCCACCTCCCTCCGG - Intronic
1060506135 9:124199632-124199654 CACAGGCCTCCACCTGCCCTGGG + Intergenic
1060627435 9:125126377-125126399 CACACACCCCCAACTCACTTTGG - Intronic
1061234678 9:129335583-129335605 CACAAGCACCCCCCTCCTTTGGG + Intergenic
1187184147 X:16968520-16968542 CTGACCCCCCCACCTCCCTCCGG + Intronic
1187503933 X:19863709-19863731 AACACCCCCCAACCTCCCTCGGG + Intronic
1187593377 X:20743461-20743483 CACTAGGCCCCACCTCCATTAGG + Intergenic
1190711560 X:53075249-53075271 CTCACTCTCTCACCTCCCTTAGG + Intronic
1190816971 X:53937834-53937856 AACATCCCCCCACCTCCATTTGG - Exonic
1192429709 X:71103653-71103675 CACACTCCACCACCTCCCCGGGG - Intergenic
1193362239 X:80591286-80591308 CTGACCCCCCCACCTCCCTCCGG - Intergenic
1197935586 X:131737065-131737087 CACCTGCCCCCACCTCCCAAAGG - Intergenic
1199608882 X:149597216-149597238 CACACTCCCCCCCCCCCCGTGGG - Exonic
1200180098 X:154144788-154144810 CCCACCCTCCCGCCTCCCTTGGG - Intronic
1200185926 X:154183182-154183204 CCCACCCTCCCGCCTCCCTTGGG - Intergenic
1200191578 X:154220320-154220342 CCCACCCTCCCGCCTCCCTTGGG - Intronic
1200197333 X:154258124-154258146 CCCACCCTCCCGCCTCCCTTGGG - Intronic
1201335822 Y:12878918-12878940 CTGACCCCCCCACCTCCCTCCGG - Intergenic