ID: 1123005972

View in Genome Browser
Species Human (GRCh38)
Location 14:105324043-105324065
Sequence GCTTTTGTGCAGGAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123005968_1123005972 -9 Left 1123005968 14:105324029-105324051 CCTGCTGGGGACTGGCTTTTGTG 0: 1
1: 0
2: 5
3: 25
4: 191
Right 1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 241
1123005961_1123005972 28 Left 1123005961 14:105323992-105324014 CCTGCTGTCAACACTGGAGTCAC 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123005972 Original CRISPR GCTTTTGTGCAGGAGATGGA GGG Intronic
901001710 1:6152078-6152100 CCATTTGGGCAGGAGGTGGAGGG - Intronic
902665402 1:17934178-17934200 GCTTGTGTGCAGGGAGTGGAGGG + Intergenic
903172045 1:21560439-21560461 GCTTTTCTGGAGGATCTGGATGG + Intronic
904689237 1:32281561-32281583 GGCTTTGTCCAGGAGATGGTGGG - Intronic
905294807 1:36947422-36947444 GCTTTTGAGCAGAGGACGGATGG - Intronic
905489084 1:38329500-38329522 GCTTCAGAGCAGGAGCTGGAGGG - Intergenic
906201932 1:43966075-43966097 CTTTTTGAGCAGGAGCTGGAGGG + Intronic
908386751 1:63650167-63650189 GCTTTTGTTCAGTAAGTGGAAGG - Intronic
908515854 1:64892277-64892299 GCTTTTTTGGGGGGGATGGAGGG + Intronic
909497570 1:76295931-76295953 GCTTTTGGGAAACAGATGGAGGG + Intronic
909789371 1:79654786-79654808 GCTATTCTGCAGCATATGGAGGG + Intergenic
910434442 1:87190953-87190975 GCTTTTCTGCTGGAGAGGGAGGG + Intergenic
911074857 1:93863206-93863228 GCTTGTGGGAAGGAGATGAAAGG + Intergenic
913192840 1:116428125-116428147 GCTTTTGTGCTGGCTTTGGAAGG - Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
915514303 1:156403862-156403884 CCTTTTGTGGAGGAGACAGAAGG + Intergenic
915945123 1:160144162-160144184 GCTTGTGTGCTGGAGATGGAGGG + Intergenic
916311863 1:163407018-163407040 GCTTTTGTGAAGGTGCTGAAGGG - Intergenic
916762479 1:167829865-167829887 GCTTTTGGGCTGGAGGTAGATGG - Intronic
923467303 1:234260806-234260828 ACTTTGGTGGAGGAAATGGAGGG - Intronic
1063683418 10:8212268-8212290 GCTTGAGTGCAGGAGATTGAGGG + Intergenic
1064551780 10:16508533-16508555 GCATCTGTGAAGGAGATAGAAGG + Intronic
1069868522 10:71518994-71519016 GCGTGGGAGCAGGAGATGGAGGG + Intronic
1072473771 10:95738477-95738499 GCTTTGGTGCAGGAAAATGATGG - Intronic
1074027080 10:109647381-109647403 GCTTTTGGGCGGGGGGTGGAGGG + Intergenic
1076197759 10:128532419-128532441 GCATTTGTGCAGGAGCCGGAGGG - Intergenic
1076498553 10:130915933-130915955 GCTTGTTTGCAGGAGATGAGGGG + Intergenic
1077131209 11:973674-973696 GCGCTGGTGCAGGAGAGGGAGGG + Intronic
1082856935 11:57816620-57816642 CCTTTTGTGGAGGGGAGGGATGG + Exonic
1083268674 11:61559501-61559523 GCTTTTGAGCAGGGGAAGGATGG + Intronic
1085474126 11:76778868-76778890 GTCTTTGTGCAGGAGGTGGCAGG + Intergenic
1086326190 11:85702402-85702424 GCTTGAGTCCAGGAGTTGGATGG - Intronic
1088555925 11:111060698-111060720 GCTTTGGGGCATGAAATGGAGGG - Intergenic
1089045761 11:115501621-115501643 GATTTTCTGCGGGGGATGGATGG + Intronic
1089393721 11:118119955-118119977 GTTTCTGTTCTGGAGATGGATGG - Intronic
1089812032 11:121140289-121140311 GTTATTGTGAAGGAGAGGGAAGG - Intronic
1090726316 11:129530403-129530425 GCTGTTGTGCAAGAGCTGGAGGG + Intergenic
1092203196 12:6600002-6600024 CCTTTACTGCAGGAGAAGGAAGG - Exonic
1093078881 12:14787075-14787097 GCTTTCATGAAAGAGATGGAAGG - Exonic
1095073281 12:37884433-37884455 GTTTTTTTGTAGGATATGGAAGG - Intergenic
1095595700 12:43955485-43955507 GCTTGTCTGCAGTAGATGTATGG - Intronic
1101862734 12:108496308-108496330 ATTTTTGTGAAGGAGATGGCAGG - Intergenic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105577473 13:21667677-21667699 GCTTTTGTTTAGGAGCTGTAAGG - Intergenic
1106242356 13:27921686-27921708 GGCTTTGTGCGGGAGAGGGAGGG + Intronic
1107399951 13:40060006-40060028 GCCTTTGAACAGGAAATGGAGGG + Intergenic
1107977903 13:45707224-45707246 GCTTGTGTGCAGGGGGTGGTGGG + Intronic
1108523228 13:51263191-51263213 GCTTTTCAGGAGCAGATGGACGG - Intronic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1111561326 13:89952053-89952075 GCTATTGTGCATGAGAAGTAGGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116095674 14:40364022-40364044 GCTGTTGTGCTGAAAATGGAAGG + Intergenic
1116366888 14:44077716-44077738 GCTGTGGTCCAGGAGACGGAGGG - Intergenic
1116480098 14:45386854-45386876 TCTTTAGTGGAGGAGATGAAGGG + Intergenic
1117240181 14:53824321-53824343 GCTTTTGTGCAGAAACTGGCTGG - Intergenic
1117344833 14:54821831-54821853 GATTTTGTGCAGGATCTGGATGG - Intergenic
1118503110 14:66381899-66381921 GCTTTCATGGAGGAGATGAAAGG + Intergenic
1121874476 14:97438926-97438948 TCATTTGTATAGGAGATGGAAGG - Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1128941580 15:71791903-71791925 GCTTGAGACCAGGAGATGGAGGG + Intergenic
1130135381 15:81177487-81177509 CCTTTTATGCAGGGGAGGGATGG + Intronic
1132190276 15:99849433-99849455 GCTTTGGGGAAGGAAATGGAAGG - Intergenic
1133255442 16:4513419-4513441 CCTTGTGTGCAGGAGAGGGGTGG - Intronic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1134083563 16:11341060-11341082 GCTATTTTGCAGGAGATTTAAGG + Intronic
1136287588 16:29253497-29253519 GCATCTGTGCTGGGGATGGAGGG + Intergenic
1137851501 16:51750372-51750394 GCATTTGTTCAGGGGAGGGAAGG - Intergenic
1138157801 16:54722125-54722147 GCATTTGTGAAGGAGCAGGAGGG - Intergenic
1139286877 16:65823165-65823187 ACGTTTTTGCAGGAGATTGAGGG - Intergenic
1141309622 16:82900768-82900790 GCTTTTGTGCAGAATAGTGAAGG + Intronic
1141800842 16:86308145-86308167 GCTTGTGAGCAGTGGATGGAGGG + Intergenic
1142640832 17:1285015-1285037 GCATTTGGGAAGCAGATGGATGG + Intronic
1143406624 17:6682043-6682065 GTTTATGTGCAAGAGATGGTGGG + Intergenic
1143562073 17:7702330-7702352 GCTTTTTTGCTAGAGAGGGAAGG - Exonic
1143573769 17:7777769-7777791 GATTGTGGGGAGGAGATGGAAGG - Intronic
1145734573 17:27218366-27218388 GCTTTGGTCTAGGAGGTGGAGGG + Intergenic
1145941755 17:28746384-28746406 GGTTTGGTGCAGGAGAAGGCGGG + Intronic
1146656135 17:34636321-34636343 GCAGTTGTGCAGGGCATGGAGGG - Intronic
1147798897 17:43067560-43067582 GGTTTTATGCAGCAGATGCAAGG + Intronic
1149684395 17:58527145-58527167 GCTTGTGAGCAGGTGAGGGAGGG - Intronic
1150286794 17:63959253-63959275 GCTTTTGTGTACCAGACGGAAGG + Exonic
1150500155 17:65643110-65643132 GCCTTTGTGGAGAAAATGGAGGG + Intronic
1153560303 18:6365708-6365730 GCATTTTTGCAGAAGATGGAAGG - Intronic
1153930096 18:9870632-9870654 GCTTCTGGGCTGGAGAAGGAGGG - Intergenic
1155174647 18:23291635-23291657 GCTGTTGTGCAGGAGAGGCCAGG - Intronic
1157331504 18:46707445-46707467 GCCTTTGTGGAGGAAATGGAAGG - Intronic
1158772575 18:60538004-60538026 ACTTGAGTCCAGGAGATGGAGGG + Intergenic
1159283246 18:66314483-66314505 GCTGTTGTGTCAGAGATGGAGGG - Intergenic
1159377114 18:67606473-67606495 GCCTTTTTGCATGAGATGGTAGG - Intergenic
1159481191 18:68993038-68993060 GCTTTTGAGCAGCAGCTGCAGGG - Intronic
1160421269 18:78747355-78747377 CCTTTTGGGCAGGAGTTGGTGGG + Intergenic
1163501955 19:17681417-17681439 GCATTTCAGCGGGAGATGGATGG + Intronic
1163562228 19:18026400-18026422 GCTTTTGTGAAAGAGGTGAAAGG - Intergenic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1166031541 19:40134456-40134478 TCTTTTGCGCAGGGGGTGGAGGG + Intergenic
1166376613 19:42331001-42331023 GCTTTGGGGCAGGGGAGGGACGG + Intronic
925781460 2:7385899-7385921 GCTGTGGAGCAGGAGAAGGAAGG + Intergenic
927873782 2:26640832-26640854 GCTCTGGTGCAGGAGACAGATGG + Intronic
928023895 2:27724259-27724281 GCCTGGGTGCAGGAGGTGGAGGG - Intergenic
928086336 2:28348463-28348485 GCTTTTGGGCAGAACATGGCTGG - Intergenic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929442292 2:41973610-41973632 GCTTTTGTAGAGGAGACAGAAGG + Intergenic
929939900 2:46325614-46325636 GCTTTTGTGCTGGTGATGTCAGG + Intronic
929956381 2:46461557-46461579 GCTTTTGTCCACAAGATGGCAGG - Intronic
930689467 2:54345473-54345495 GCTTTTGAGAAAGAGAAGGAAGG + Intronic
931046275 2:58357513-58357535 CCTTTTGTGCATGTGAAGGAGGG + Intergenic
931360444 2:61573388-61573410 GCTTTAGGCCAGGAGTTGGAGGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932054902 2:68433594-68433616 TCATTTGTGCAGGAGTTGGCTGG - Intergenic
932745958 2:74333776-74333798 GCATTTAGCCAGGAGATGGAAGG - Intronic
932749524 2:74362531-74362553 GCAATTGGGGAGGAGATGGAAGG - Intronic
932765741 2:74468500-74468522 GCTTGAGCCCAGGAGATGGAGGG + Intergenic
933849676 2:86355838-86355860 ACCTTTGGGCAGGAAATGGAGGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934682688 2:96296549-96296571 TCCTTGGTGCAGGAGATGGTGGG - Exonic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
937460556 2:122082022-122082044 GCCTGTCTGCAGGAGAGGGAAGG - Intergenic
937936573 2:127250055-127250077 GCTTTCATGAAAGAGATGGAAGG + Intergenic
939654166 2:144802052-144802074 GCATTTGTGCAGGAGCTAAATGG + Intergenic
941002385 2:160215618-160215640 GCTTTTCAGCAGGATTTGGAGGG - Intronic
941415499 2:165216057-165216079 GCTGTTGTGCAGGAAATGAATGG + Intergenic
941959022 2:171235524-171235546 GCTTCTGTGCAGGAGATAGGAGG + Intergenic
946450262 2:219773616-219773638 GCTTCTGGGCACAAGATGGAAGG - Intergenic
947476850 2:230457776-230457798 GTGTTTCTGCAGGGGATGGAGGG + Intronic
1168874524 20:1161669-1161691 GCATTTGTGGTGGACATGGAGGG - Intronic
1169624786 20:7553206-7553228 ACTTTGGTGCAGGATATTGATGG - Intergenic
1170732598 20:18987638-18987660 TCTTTGGTGGAGGAGGTGGATGG - Intergenic
1171104565 20:22420485-22420507 GATTTGGTGCAGGAGAGGAAGGG + Intergenic
1173131573 20:40398871-40398893 GATTCTGTGCTGGAGAAGGAAGG - Intergenic
1173559639 20:43993794-43993816 GCTTTTGTGTAGGACATCCAAGG + Intronic
1174508702 20:51034705-51034727 GCATTTGTGTAGGAGAAGCATGG - Intergenic
1175304015 20:57963623-57963645 GCTTAAGGCCAGGAGATGGATGG + Intergenic
1175803562 20:61814518-61814540 TTGTTTGTGCAAGAGATGGAAGG + Intronic
1178522041 21:33294603-33294625 GGTTTTGAGCAGCTGATGGAGGG - Intronic
1179874309 21:44260146-44260168 GCTTTTGGGCAGGAGTTGACAGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1183945949 22:41325796-41325818 GCTCTGGTGCAGTACATGGAAGG + Exonic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949383394 3:3470555-3470577 GCTTTAGTGCAGGAAAAAGATGG - Intergenic
949488392 3:4563766-4563788 GCTTGTGTGCAGGATTTGGTGGG + Intronic
950028540 3:9836742-9836764 GCTTGAGTCCAGGAGTTGGAGGG + Intronic
950886367 3:16366305-16366327 GCTGTTGTGGAGGAGTTGGGTGG - Intronic
952210448 3:31224527-31224549 GCTTCTGTGCTGGAGAAGGCTGG + Intergenic
952798541 3:37265941-37265963 GCTTGAGTCCAGGAGGTGGAGGG + Intronic
953262361 3:41352238-41352260 GCATTTGTGGAGGAGCAGGAAGG - Intronic
953365650 3:42342162-42342184 GCCGTGGTCCAGGAGATGGAGGG + Intergenic
954308799 3:49748359-49748381 GCTTCTGTGCACAAGATAGATGG - Intronic
955338827 3:58109167-58109189 GCTTTTTTGCAGGATGGGGAAGG + Exonic
955844642 3:63149260-63149282 GCTTTTAAGCAGGAGAGTGACGG + Intergenic
956324096 3:68031553-68031575 TCGTTTGTGGAGGAGATGGCCGG + Intronic
959110742 3:102119479-102119501 GCTCTTGTAAAAGAGATGGAAGG - Intronic
960372562 3:116859241-116859263 GCTTTTGTGCAGAGAATGAAAGG - Intronic
960912377 3:122662236-122662258 GCTGTGGTCCAGGAGATGGAGGG + Intergenic
961093735 3:124137479-124137501 GCATTTGTGCAGAGGATGTAAGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
965857772 3:173109328-173109350 GCTTTTGTGTGGGAAAGGGAGGG + Intronic
966053581 3:175653191-175653213 GCCTATATGGAGGAGATGGAAGG + Intronic
967535035 3:190592370-190592392 GCTGTTGTGCAGAATAAGGAAGG - Intronic
967889838 3:194357156-194357178 CTTTTTGTGCAGGAACTGGAAGG + Intronic
968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG + Exonic
969312870 4:6364271-6364293 GCTCTGCTGCAGGAGATGGCTGG + Intronic
971185625 4:24373037-24373059 GCTTCTGTGCAGCCGATGGGAGG - Intergenic
971906750 4:32736106-32736128 GCATTTGGGAAGGAGGTGGAAGG - Intergenic
972279322 4:37587191-37587213 GCTTATGAGAAGGAGGTGGAGGG - Intronic
977749111 4:100587357-100587379 GCTTTTGGGGAGGAAATGGTGGG + Intronic
981613170 4:146618326-146618348 TCTTTGGTGCCAGAGATGGAGGG - Intergenic
981956327 4:150478321-150478343 GGTTGTGTGGAGGAGGTGGAGGG - Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
984793505 4:183635926-183635948 GCTTTCCTTCAGCAGATGGACGG + Intergenic
984952032 4:185015118-185015140 GCTTGGGGGCAGGGGATGGATGG - Intergenic
985543952 5:500003-500025 GCTGTTGGGCAGGAGCTGCAGGG + Intronic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
986853070 5:11835341-11835363 GCTTTTGTGCAGAAAACAGAAGG - Intronic
988074212 5:26332227-26332249 GATTTTGTGCATGACCTGGATGG - Intergenic
989268703 5:39506703-39506725 GCTTCTATGCAGCTGATGGAGGG - Intergenic
989605686 5:43242364-43242386 GCAGCTGGGCAGGAGATGGAGGG + Intronic
990507100 5:56455736-56455758 GTTTTGGTGGAGGAGCTGGAAGG - Intergenic
991291393 5:65036581-65036603 GCTTTTGTGCCTGTGAAGGAAGG + Intergenic
991564766 5:67993416-67993438 TCTTCTGAGCTGGAGATGGATGG + Intergenic
992982606 5:82192016-82192038 GCATTTGTGCAGGATTTGGAAGG + Intronic
993801743 5:92351351-92351373 GCTTCTGTGCCTGTGATGGAGGG - Intergenic
996062849 5:119051070-119051092 CCTTTTCTTCAGGTGATGGAAGG + Intronic
996193230 5:120571067-120571089 GCATTTGAGCAGAGGATGGAGGG + Intronic
996770683 5:127082409-127082431 GCTTTGGTGGAGGAGATGAGGGG + Intergenic
997212503 5:132085760-132085782 GCTGATATGAAGGAGATGGATGG - Intergenic
997425744 5:133801535-133801557 GCTGTTGTGCAGGTGAGAGATGG - Intergenic
997608651 5:135194878-135194900 GCTTTTGTGCAGGAAACAAAAGG - Intronic
997910696 5:137870228-137870250 GCTTGTGCCCAGGAGTTGGAGGG + Intronic
998862393 5:146457491-146457513 GTTTTTGTGCAGCAGATATAAGG + Intronic
999458427 5:151737173-151737195 GCTGCTGTGCAGGTGAAGGAAGG + Intergenic
999508765 5:152225904-152225926 GCTTTGGAGGGGGAGATGGAGGG + Intergenic
1000199787 5:158997068-158997090 GCTTTTGTGGAGGATGAGGAGGG - Intronic
1001024673 5:168214076-168214098 GCTTTTTTGCAGGGGCTGGAGGG - Intronic
1001028469 5:168244341-168244363 GCTTCTGTGGAGGACATGGCTGG - Intronic
1001536631 5:172502742-172502764 GCTTTTGAGGAGGAGGTGGTGGG + Intergenic
1001864319 5:175090155-175090177 CATCTTGGGCAGGAGATGGAAGG - Intergenic
1002086779 5:176780843-176780865 GGTTTCTGGCAGGAGATGGAAGG - Intergenic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1005814195 6:29537787-29537809 GCTTTGTTGAATGAGATGGAAGG - Intergenic
1005873200 6:29992795-29992817 GCTTTTTGGCAGGGGATGGCAGG + Intergenic
1006108598 6:31730795-31730817 GCCTTTGTGGAGAAAATGGAGGG + Exonic
1006981579 6:38152142-38152164 GCCTTTGTCCAGAGGATGGAGGG - Intronic
1006991786 6:38221373-38221395 GCTTTTGGACAGGAGGTGGCTGG - Intronic
1007326015 6:41060202-41060224 GCCTTTGAGGAGGAGATGGATGG - Intronic
1007423325 6:41732893-41732915 GCCTTTGTCCTGGGGATGGAGGG - Intronic
1007660246 6:43479962-43479984 GCTTTTTTTCTTGAGATGGATGG - Intronic
1009279606 6:61730652-61730674 GCTTTTGAGCTGGGGCTGGAAGG + Intronic
1009846918 6:69146063-69146085 GCTTTTGGGCAGAAAAGGGAGGG - Intronic
1011585130 6:88916388-88916410 GCTTGAGTCCAGGAGGTGGAGGG + Intronic
1012097853 6:94987772-94987794 GATTTTTTGCAGGAGTGGGAAGG + Intergenic
1013515773 6:110884514-110884536 GCTTGAGCCCAGGAGATGGAGGG - Intronic
1015404124 6:132818264-132818286 CCTTTTGTGCAGGAGCGAGAGGG + Intergenic
1016518378 6:144922567-144922589 GCTGTTGTGCAGGACTCGGAGGG + Intergenic
1018619475 6:165715991-165716013 ACTTTAGTGCAGGAGCCGGAGGG - Intronic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1022027736 7:26464629-26464651 GCTTGTGTGAAGGAGGAGGAGGG + Intergenic
1022037403 7:26547626-26547648 GCCTTTTTTCAGGGGATGGAGGG + Intergenic
1023523498 7:41073069-41073091 GTTCTTGGGCAGGAGATGGGAGG + Intergenic
1023555927 7:41423016-41423038 GCTATTCTGCAGGAAATGAATGG + Intergenic
1024609220 7:51049335-51049357 TCTTTTATGAAGGAGAAGGAGGG + Intronic
1027973118 7:85112624-85112646 GCTTTTGGGCAAGAGATTCAGGG + Intronic
1028752672 7:94398651-94398673 GTTTTTATTCTGGAGATGGAAGG + Intronic
1030205211 7:106945765-106945787 GCTTGAGCCCAGGAGATGGAGGG - Intergenic
1032316592 7:130843856-130843878 GCTCTTGTGGGGGAAATGGAGGG - Intergenic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1034148018 7:148889443-148889465 GCTTGAGCCCAGGAGATGGAGGG - Intergenic
1035600922 8:896322-896344 GGTTTTGTGCAGGACCTGGCCGG + Intergenic
1035812843 8:2506813-2506835 GCTTTTCTGAAGGAGATTGCAGG + Intergenic
1036942406 8:13064297-13064319 GCTTTTGGGTAAGAGTTGGAAGG + Intergenic
1039829344 8:41200585-41200607 GCATTTGTGCATGTGATGGATGG - Intergenic
1040959356 8:53014789-53014811 GTTTGTGTGCAGGAGGTGGCTGG - Intergenic
1044534385 8:93342791-93342813 GCTTTTCTGCAGAAGATGAGTGG - Intergenic
1044621223 8:94192312-94192334 GGCTTTATGCAGGAGTTGGAGGG + Intronic
1046202396 8:110944451-110944473 GCTTTAGTGTAGGAGTTGGTAGG + Intergenic
1047987347 8:130248626-130248648 GCTGTTGTGGTGGAAATGGAAGG + Intronic
1048945255 8:139441088-139441110 GCTTGAATCCAGGAGATGGAGGG + Intergenic
1049429116 8:142551007-142551029 GCTTTATTGGAGGAGAGGGATGG + Intergenic
1049492293 8:142911848-142911870 CCATTTGTGCAGGAGCTGGCTGG + Exonic
1049785893 8:144450595-144450617 GCTCTTGAGGAGGAGCTGGAAGG + Exonic
1051050826 9:12929949-12929971 GATTTTGTGCAGGGGCAGGATGG + Intergenic
1051092993 9:13432031-13432053 GCTATTGTGCAGGAATAGGATGG - Intergenic
1051405389 9:16732143-16732165 TTTTTTTTGCAGGAAATGGAGGG - Intronic
1051439351 9:17067377-17067399 GATTTAGAGCAGGAGTTGGACGG + Intergenic
1051728702 9:20115321-20115343 GATTTCGGGCAGGAGATTGAAGG + Intergenic
1052684210 9:31733715-31733737 GCTTTTGTGGAGGTTGTGGAGGG + Intergenic
1052694113 9:31854313-31854335 GCTTGTGTGCTGGTGGTGGAGGG - Intergenic
1055005882 9:71505570-71505592 GCTTTTGTCTAGGACATGCAAGG - Intergenic
1057563539 9:96147651-96147673 GCCGTGGTCCAGGAGATGGAGGG + Intergenic
1058958731 9:109972804-109972826 GCAATTGTGCAGGAGATATAGGG - Intronic
1059382904 9:113942142-113942164 GCTTTTGAGCAGGACTTTGAAGG + Intronic
1061624733 9:131835040-131835062 GCTTTTGTGCAGGAGGAGCGAGG - Intergenic
1062296059 9:135827857-135827879 GCTTTTGTGCGGGTGCTAGACGG - Intronic
1187788432 X:22920239-22920261 GTTTGTGTGTAGGAGAGGGAGGG - Intergenic
1189007844 X:37013639-37013661 GCATTTGTGGAAGAGAAGGAGGG + Intergenic
1189255135 X:39632126-39632148 GCTTTGTTGCAGCAGATGGTGGG - Intergenic
1198135636 X:133747322-133747344 ATGTTTGTGCAGGTGATGGAAGG - Intronic
1198844109 X:140891100-140891122 TCTTTTCTGTAGGAGATGAAAGG - Intergenic
1198871210 X:141178499-141178521 GATTTTGAGCAGGAGAGTGAAGG - Intergenic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic