ID: 1123006405

View in Genome Browser
Species Human (GRCh38)
Location 14:105325886-105325908
Sequence GAGAGTAAACAAAGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 389}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123006405_1123006417 25 Left 1123006405 14:105325886-105325908 CCTCCATGCCTTTGTTTACTCTC 0: 1
1: 0
2: 1
3: 39
4: 389
Right 1123006417 14:105325934-105325956 CATCAGGACAGAGGTGACCAGGG 0: 1
1: 0
2: 2
3: 16
4: 272
1123006405_1123006415 16 Left 1123006405 14:105325886-105325908 CCTCCATGCCTTTGTTTACTCTC 0: 1
1: 0
2: 1
3: 39
4: 389
Right 1123006415 14:105325925-105325947 CCACATCTGCATCAGGACAGAGG 0: 1
1: 0
2: 2
3: 23
4: 210
1123006405_1123006416 24 Left 1123006405 14:105325886-105325908 CCTCCATGCCTTTGTTTACTCTC 0: 1
1: 0
2: 1
3: 39
4: 389
Right 1123006416 14:105325933-105325955 GCATCAGGACAGAGGTGACCAGG 0: 1
1: 0
2: 3
3: 32
4: 210
1123006405_1123006412 9 Left 1123006405 14:105325886-105325908 CCTCCATGCCTTTGTTTACTCTC 0: 1
1: 0
2: 1
3: 39
4: 389
Right 1123006412 14:105325918-105325940 GGGAGTCCCACATCTGCATCAGG 0: 1
1: 0
2: 1
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123006405 Original CRISPR GAGAGTAAACAAAGGCATGG AGG (reversed) Intronic
900529249 1:3144649-3144671 GAGAGGAAACCAAGGCGTGGGGG + Intronic
900841986 1:5058742-5058764 GAGAGAAAAGCCAGGCATGGTGG + Intergenic
901355590 1:8645046-8645068 ATGAGGAAACAAAGACATGGAGG - Intronic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902545497 1:17186965-17186987 GAGAATAATAAAAGGCAAGGAGG - Intergenic
903315324 1:22499283-22499305 GAGAGAAAACACAGGCAAGATGG + Intronic
903994878 1:27299526-27299548 TGGTGTGAACAAAGGCATGGGGG + Intronic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904386480 1:30145897-30145919 GAGAAGAAACCAAGGCAGGGAGG + Intergenic
904504496 1:30939589-30939611 GAGAGTAACCAAAGGGCAGGTGG - Intronic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
906703471 1:47876771-47876793 AAGAGTAAACAGAGACATGAAGG - Intronic
906815034 1:48870003-48870025 TAGCATAAGCAAAGGCATGGAGG - Intronic
909221668 1:72970793-72970815 GAGAGGAAAAAAAAGCATGAGGG - Intergenic
909992546 1:82240449-82240471 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
910766411 1:90787086-90787108 GAGAGTGAACACAGGCATTAAGG - Intergenic
912748041 1:112262234-112262256 CAGAGTAAGCAAAGGCATAGAGG + Intergenic
913182647 1:116337005-116337027 GAGGGAAAAGAAAGGAATGGGGG - Intergenic
913583359 1:120249215-120249237 GAGAGTAAACAATGCCAAAGAGG - Intergenic
913624813 1:120649107-120649129 GAGAGTAAACAATGCCAAAGAGG + Intergenic
914565346 1:148861051-148861073 GAGAGTAAACAATGCCAAAGAGG - Intronic
914607479 1:149269197-149269219 GAGAGTAAACAATGCCAAAGAGG + Intergenic
914872118 1:151483898-151483920 AATGGTAAACTAAGGCATGGTGG - Intergenic
914946699 1:152073194-152073216 CAGCATTAACAAAGGCATGGAGG - Intergenic
915271442 1:154756485-154756507 GAGAGTAAACAGATGAAGGGGGG - Intronic
916528264 1:165631573-165631595 GAGAGGAAAGGAAGGAATGGAGG - Intronic
916611379 1:166395247-166395269 GGGAGAAAAGAGAGGCATGGAGG + Intergenic
918839164 1:189512805-189512827 GAGAGTAAGAAAAGACAGGGTGG + Intergenic
919607834 1:199707678-199707700 GAGAGTAAATAAAGGCAAACTGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
919864335 1:201768348-201768370 AAGAGTAAGTACAGGCATGGTGG + Intronic
922710755 1:227829066-227829088 GAGAATGAAGAAAGGCAGGGTGG - Intronic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
924662256 1:246031907-246031929 GATTTTAAACAAAGGCAGGGTGG - Intronic
924733690 1:246735474-246735496 GTGAATAAATAAAGGCATGATGG - Intronic
924841065 1:247709963-247709985 GGAAGTAAACAGAGGCATTGGGG + Intergenic
1065352927 10:24811707-24811729 TACAGTAAACAAAGTCAAGGGGG - Intergenic
1066226886 10:33392520-33392542 AACAGTATTCAAAGGCATGGAGG - Intergenic
1070424057 10:76268271-76268293 GAGAGGAAACTAAGGCACAGAGG - Intronic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1071495435 10:86164652-86164674 GAGTTTAAGCCAAGGCATGGAGG + Intronic
1071804210 10:89099060-89099082 GAGCACAAACAAAGGCCTGGAGG + Intergenic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1072973305 10:100036444-100036466 GAGAGAAAAAAAAGACAGGGTGG + Intergenic
1073580598 10:104662417-104662439 ATGAGTAAATAAAAGCATGGTGG + Intronic
1073852995 10:107643038-107643060 GAGAATAAACATAGCCCTGGAGG + Intergenic
1073961249 10:108931624-108931646 GAGCTTAAGCAAAGCCATGGCGG - Intergenic
1077785786 11:5382256-5382278 TAGTGTAAGCAAGGGCATGGAGG - Intronic
1078194267 11:9121846-9121868 GTGGGGAAACCAAGGCATGGGGG - Intronic
1079080549 11:17410681-17410703 GAGGGTAGGGAAAGGCATGGTGG + Intronic
1081280069 11:41198620-41198642 GAGAGGAAAAAAAAGTATGGAGG + Intronic
1082218855 11:49608222-49608244 GAGAGAAAACAAAAGCAATGAGG + Intergenic
1083962819 11:66023761-66023783 GTGAGCAAAGAAAGGCATGGAGG - Intronic
1084520316 11:69658633-69658655 GTGATTAAACAAAGGCAAGGAGG - Intronic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1085620541 11:78034849-78034871 GAGAGTGAATAAAAGCAGGGTGG - Intronic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1086342859 11:85865029-85865051 TAGAGTAAACAAAAGTAGGGAGG + Intronic
1087508892 11:99064580-99064602 GATGGTAAATAAAGGGATGGAGG - Intronic
1087776275 11:102259829-102259851 GAGGTTAGGCAAAGGCATGGTGG - Intergenic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1088246168 11:107820282-107820304 GAGAGAAAAGAAAGGGAGGGAGG + Intronic
1088738114 11:112745373-112745395 AAGAGGAAACTGAGGCATGGGGG + Intergenic
1088853170 11:113722074-113722096 CAGCCTAAGCAAAGGCATGGAGG - Intergenic
1088857805 11:113772222-113772244 GAAAGCAAAGAAAGGCATGTTGG + Intronic
1089930333 11:122303675-122303697 GAGAGGACCCAAAGGAATGGGGG + Intergenic
1089957898 11:122589389-122589411 GAGAGGAAAAAAAGGCAATGGGG + Intergenic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090586793 11:128221859-128221881 TGGGGTAAACAAAGACATGGAGG - Intergenic
1091549075 12:1524221-1524243 AAGAGTAAACAAAGCTATGATGG - Intergenic
1092567681 12:9685631-9685653 CAGTGTAAACAAAGCCCTGGGGG - Intronic
1093308847 12:17553339-17553361 GAGAGAAAACAAAGCCAAAGAGG + Intergenic
1093757114 12:22865049-22865071 GAGACAAAAGAAAGGCATGGAGG - Intergenic
1093819049 12:23589396-23589418 CACAGTAAACAAACTCATGGAGG + Intronic
1094575324 12:31679691-31679713 GACAGTATTCAAAGACATGGAGG - Intronic
1095135430 12:38595526-38595548 AAGAGTAAACAAAAGGATTGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096849108 12:54424324-54424346 GAGAGAAAGGAAAGTCATGGGGG - Intergenic
1097802639 12:63931844-63931866 GAGAATAGACAAAGGAATGAGGG + Intronic
1098086318 12:66848206-66848228 GAGAGAAAAGAAAGGGAAGGAGG - Intergenic
1098105463 12:67065410-67065432 AAGAGGAAAAAAAGGCAAGGGGG + Intergenic
1098231539 12:68376258-68376280 GAGAGTATGCAAAGGCAGTGAGG - Intergenic
1098446170 12:70568047-70568069 CAGAGAAAACAAAGCCCTGGAGG - Intronic
1099398936 12:82178605-82178627 GAGCCTAAACAAAGGTATTGAGG + Intergenic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1100490721 12:95075237-95075259 AAGAAAAAAAAAAGGCATGGTGG + Intergenic
1101520549 12:105478425-105478447 TAGAAAAAAAAAAGGCATGGTGG - Intergenic
1102300148 12:111765895-111765917 CAGAGGAAGAAAAGGCATGGGGG - Intronic
1102783427 12:115584924-115584946 GAGATTCAGCAAAGCCATGGGGG - Intergenic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1104522273 12:129486706-129486728 GAGAAGAACCACAGGCATGGAGG - Intronic
1104987498 12:132605055-132605077 GAGGGTAAACCAAGGCACTGAGG + Intronic
1105783324 13:23723290-23723312 AAAAGAAAACAAAGGGATGGTGG - Intergenic
1107661463 13:42643464-42643486 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1108850086 13:54717899-54717921 GAGACAAAATAAAGGGATGGAGG - Intergenic
1110893168 13:80715276-80715298 GAGAGTAGACAAAAGCAAGCAGG + Intergenic
1111919695 13:94397154-94397176 GAGAGGAAAGAAGGGCATTGGGG + Intronic
1115267078 14:31511802-31511824 CACAGTGAGCAAAGGCATGGAGG + Intronic
1115267939 14:31520895-31520917 GAGATGAAACACAGGGATGGGGG + Intronic
1115828094 14:37300160-37300182 GAGTATGAACAAAGGAATGGAGG - Intronic
1115902573 14:38169347-38169369 TAGGATAAACAAAGTCATGGAGG + Intergenic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117649208 14:57885069-57885091 TACAGTATACATAGGCATGGTGG + Intronic
1117688659 14:58282097-58282119 GAGTGGGAAAAAAGGCATGGAGG - Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1118346233 14:64943050-64943072 GAGAGGAAAAAAAGGGAGGGAGG + Intronic
1118875700 14:69783200-69783222 GAGAATAAATAAAGGAATGAAGG - Intronic
1119129424 14:72157815-72157837 AAGAATGAACAAAGGAATGGTGG - Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120719018 14:87870309-87870331 GAGAGTAATTAAAGGTATGAAGG + Intronic
1121676136 14:95754540-95754562 TAAGATAAACAAAGGCATGGAGG - Intergenic
1123006405 14:105325886-105325908 GAGAGTAAACAAAGGCATGGAGG - Intronic
1123473083 15:20569115-20569137 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1123644923 15:22431238-22431260 GTGGGGAAACAAAGGCCTGGAGG + Intergenic
1123733382 15:23164126-23164148 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1123751511 15:23361497-23361519 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1124283884 15:28385422-28385444 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1124298814 15:28526192-28526214 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1124959277 15:34382734-34382756 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1124975903 15:34528955-34528977 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1127137154 15:55936172-55936194 GAGAGTAAATACAGGGTTGGGGG - Intronic
1127431171 15:58910200-58910222 GAAAGTAAACAGAGGCATAGGGG + Intronic
1128077857 15:64839497-64839519 GCGTGTAATCAATGGCATGGAGG - Intergenic
1128882388 15:71255741-71255763 GAGAGCAAACTGAGGCATGGAGG - Intronic
1128894025 15:71356608-71356630 GAGAGTGAAGGAAGGCAGGGAGG + Intronic
1128989344 15:72245827-72245849 GGTAGTAAACAAAGGCCAGGGGG + Intronic
1129029826 15:72610062-72610084 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1129038034 15:72662801-72662823 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1129211855 15:74074430-74074452 GTGGGGAAACAAAGGCCTGGAGG + Intronic
1129374349 15:75118809-75118831 AAAAGAAAACAAAGGCATGTAGG - Intergenic
1129374424 15:75119472-75119494 AAAAGAAAACAAAGGCATGTAGG - Intergenic
1129398548 15:75266654-75266676 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1129402156 15:75290930-75290952 GTGGGGAAACAAAGGCCTGGAGG - Intronic
1129728975 15:77918702-77918724 GTGGGGAAACAAAGGCCTGGAGG + Intergenic
1129839527 15:78735164-78735186 GTGGGGAAACAAAGGCCTGGAGG - Intergenic
1129896981 15:79115723-79115745 GACAGCAAGCAAAGGCATGGTGG - Intergenic
1129979280 15:79851809-79851831 GAGATTAAGTAAAGGTATGGAGG + Intronic
1130698576 15:86156206-86156228 GTGAGAAAAAAAGGGCATGGTGG - Intronic
1131188019 15:90292175-90292197 GTGGGGAAACAAAGGCCTGGCGG - Intronic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131715561 15:95106944-95106966 ATGAGTAAACAGAGGCATGGAGG - Intergenic
1132432927 15:101775218-101775240 GTGGGGAAACAAAGGCCTGGAGG + Intergenic
1132739652 16:1405250-1405272 GAGAGGAAAGAAAGACAGGGAGG + Intronic
1134807336 16:17137233-17137255 GTAAGGAAACGAAGGCATGGAGG - Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136077892 16:27829323-27829345 TAGTGTGTACAAAGGCATGGAGG + Intronic
1136141129 16:28289443-28289465 CCGAGTAGACAAAGGCGTGGAGG + Intergenic
1138106681 16:54290754-54290776 ACGAGAAAAAAAAGGCATGGGGG - Intergenic
1139338126 16:66247689-66247711 AAGAGGAAACAGAGGCGTGGAGG + Intergenic
1139456890 16:67087021-67087043 CAGTGTATGCAAAGGCATGGAGG + Intronic
1139478957 16:67217782-67217804 GAGAGTAAAAAGAGACATAGAGG - Intronic
1141398437 16:83725231-83725253 TGGGATAAACAAAGGCATGGTGG + Intronic
1141769574 16:86081470-86081492 GAGAGGAAGCAAAGGCACAGAGG + Intergenic
1141847098 16:86618300-86618322 TAGCTTGAACAAAGGCATGGAGG - Intergenic
1143311007 17:5989186-5989208 AAGATTAAACAAAGGCTTGGAGG + Intronic
1143855072 17:9842470-9842492 GAAAGTAAACAAAGCTCTGGAGG - Intronic
1145249938 17:21291782-21291804 GTGAGTAAACTGAGGCCTGGTGG + Intronic
1145898097 17:28472406-28472428 AAGAGTGAACGAAGGCCTGGAGG - Intronic
1146610432 17:34300057-34300079 CACTGTAAACAAAGGCATGTGGG + Intergenic
1148976423 17:51533811-51533833 GAGAGAAAAAAAAGGCTTGCAGG + Intergenic
1151764552 17:76125446-76125468 GGGAGTGAGCAAAGGCATGGAGG - Intergenic
1152135701 17:78501966-78501988 TACTGTAAACAAAAGCATGGTGG - Intronic
1152297334 17:79475721-79475743 GACAGGATACACAGGCATGGGGG + Intronic
1155456483 18:26020849-26020871 TAGCTGAAACAAAGGCATGGAGG + Intronic
1156385424 18:36600317-36600339 GGGAGTTAACAAAGGCAATGAGG + Intronic
1157501607 18:48194553-48194575 CAGAGTAAACAGAGGCTTGCAGG + Intronic
1158540946 18:58354084-58354106 GACAGCAAACAAAGGAATCGAGG - Intronic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1158687891 18:59631212-59631234 GAGAAAAAAAAAAGGCATGAAGG + Intronic
1159108861 18:64032926-64032948 GAGAGTAGACCTAGGAATGGTGG + Intergenic
1159322243 18:66866922-66866944 TAGAGTAAGCTCAGGCATGGCGG - Intergenic
1160130770 18:76223058-76223080 GAAAAGAAACAAAGTCATGGTGG - Intergenic
1160446085 18:78927856-78927878 GAGAGTATACAGAAGCCTGGGGG - Intergenic
1161619932 19:5292641-5292663 GAGCGGAAACAAATGGATGGAGG + Intronic
1163226528 19:15965297-15965319 GAAAGTAAATAAAAGCATTGGGG - Intergenic
1163428892 19:17254942-17254964 CAGAATATACAAAGGCTTGGAGG + Intronic
1166114212 19:40642900-40642922 AAGAGTTAACAAAGGCATCCAGG - Intergenic
1166511232 19:43410295-43410317 TGGGGTAAACAAATGCATGGGGG + Intronic
1166650926 19:44574630-44574652 GAGTGTAAGCAAAGGCCCGGTGG + Intergenic
1167727084 19:51223398-51223420 GAGATTTGACAAAGGTATGGTGG + Intergenic
925030184 2:644379-644401 TAGAGTAAATGAAGGGATGGAGG + Intergenic
925030194 2:644457-644479 TAGAGTAAATGAAGGGATGGAGG + Intergenic
928614905 2:33028101-33028123 AAGAGTAGACCATGGCATGGAGG + Intronic
930096293 2:47569579-47569601 GAGAGGAAACTGAGGCCTGGGGG + Intronic
930242176 2:48947273-48947295 GAGAGTAGAGAAAGGAATAGAGG + Intergenic
930326140 2:49921322-49921344 GAGAGGAAAAAAAAGTATGGAGG - Exonic
930557795 2:52921882-52921904 GAGAGTAAACAAGGACATGAAGG + Intergenic
931230984 2:60374678-60374700 GTGAGTAAACTGAGGCACGGTGG + Intergenic
931288005 2:60848877-60848899 GAGAGAAGACAAATGCAGGGCGG + Intergenic
932102794 2:68916035-68916057 GAGAGCAAATGAAGGCCTGGTGG + Intergenic
933277052 2:80295079-80295101 GAGAAGAAAAAAAGGCAAGGTGG - Intronic
934460074 2:94209081-94209103 GAGTGTAGAAAAAGGCATCGGGG + Intergenic
934950292 2:98571266-98571288 GTGAGGAAACTGAGGCATGGAGG + Intronic
935797311 2:106657294-106657316 GAGAGAAAACAAAGGAGTAGGGG - Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936761849 2:115795405-115795427 GAAAGGAAAGAAAGTCATGGAGG - Intronic
937111583 2:119370881-119370903 GAGAGAAAACAAAGTCAATGGGG + Intronic
938981890 2:136534932-136534954 GTGAGCAGGCAAAGGCATGGGGG - Intergenic
939406577 2:141766012-141766034 GAGAGGAAACAAAAGCAATGGGG - Intronic
939695964 2:145325023-145325045 GAAAGTAAGCAAAGGCATTTTGG - Intergenic
939884829 2:147670217-147670239 GAGAAGAAAGAGAGGCATGGAGG + Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
942701368 2:178714862-178714884 GAGAGGAAACAAAGGGAAAGTGG + Intronic
943821066 2:192321457-192321479 GAGATTAAAGAAAGGTATGATGG + Intergenic
944424988 2:199571676-199571698 GAGAGAAAACAAACCCAGGGAGG - Intergenic
944472694 2:200071938-200071960 CAGTATAATCAAAGGCATGGAGG + Intergenic
945108988 2:206344769-206344791 GAGAGGGAACAAGGGGATGGGGG - Intergenic
945269095 2:207920968-207920990 GAGTGTAAAGGAAGGCAGGGAGG - Intronic
945653188 2:212590471-212590493 GAGAGAAGACACAGGGATGGTGG + Intergenic
945653386 2:212592714-212592736 GAGAGAAGACACAGGGATGGTGG + Intergenic
947218939 2:227774321-227774343 TATAGTAAACAAATGCCTGGAGG - Intergenic
948392379 2:237621741-237621763 GAGAGTAAACAAATGCACACTGG - Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
948860773 2:240751689-240751711 GAGTGTCACCAAGGGCATGGGGG - Intronic
1169768569 20:9176163-9176185 TAGAGGAAACAATAGCATGGAGG - Intronic
1172420828 20:34816131-34816153 GAGAGTAACCAAAGGAATGATGG - Intronic
1173868480 20:46327889-46327911 ACGAGTAAACTGAGGCATGGAGG - Intergenic
1174236633 20:49099007-49099029 AAGAGAAAAAAAAGGCATAGAGG - Intergenic
1174642530 20:52056854-52056876 GGGAGTAAAGGAAGGGATGGTGG + Intronic
1174735586 20:52962734-52962756 GTGAGTAAAGAAAGGGAAGGTGG - Intergenic
1175197532 20:57254793-57254815 GACCGTACACAAAGGCATGCTGG + Intronic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1176951961 21:15058388-15058410 GAGAATACACAATGACATGGAGG - Intronic
1177040110 21:16097707-16097729 GAGAGAAAACAGAGGCAGAGAGG - Intergenic
1179077239 21:38134264-38134286 GAGAGTCAACATGGGTATGGAGG - Intronic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1181046123 22:20215135-20215157 GAGAGTAAACTGAGGCATGTGGG + Intergenic
1181901819 22:26162260-26162282 ATGAGTAAACAGAGGCTTGGAGG - Intergenic
1181927343 22:26370568-26370590 GAGAAGAAAGAAAGGGATGGAGG - Intronic
950099232 3:10346949-10346971 GAGAGGAAACAAAGTGATGCTGG - Intronic
950659775 3:14460047-14460069 CAGAGTGAAGAAGGGCATGGTGG - Intronic
950915358 3:16639018-16639040 GAGAGTAGGGAAATGCATGGTGG + Intronic
951456310 3:22896145-22896167 GAGATCACACAGAGGCATGGAGG - Intergenic
953481968 3:43259554-43259576 GAGAGGACACTAAAGCATGGAGG - Intergenic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
953621300 3:44535205-44535227 GAGAGGCAACAAAGGAAAGGAGG - Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954425867 3:50442863-50442885 CTGAGTAGACAAAGGCCTGGAGG - Intronic
955113696 3:55975376-55975398 GGAAGAAAATAAAGGCATGGTGG - Intronic
955746691 3:62147814-62147836 GACAGTAAACAAAGGAATGCTGG + Intronic
955952353 3:64255197-64255219 GAGAGTAAACTTGTGCATGGAGG - Intronic
956553304 3:70487222-70487244 TAGAGAAAATAAAGGCATGACGG - Intergenic
956835679 3:73094479-73094501 AAAAGAAAAGAAAGGCATGGTGG - Intergenic
957435994 3:80177235-80177257 GAAAGTATGCAAAGGCATAGGGG - Intergenic
957659547 3:83129655-83129677 GAGAGCAAGGAAAAGCATGGTGG + Intergenic
957927371 3:86832014-86832036 GATACTAAACAAAGGGAAGGGGG + Intergenic
958867470 3:99517811-99517833 AAGACTAAGCCAAGGCATGGTGG - Intergenic
960345133 3:116521476-116521498 GATAGAACACAAGGGCATGGTGG + Intronic
961235884 3:125366753-125366775 TAGCGTAAGCAAAGGCTTGGAGG - Intronic
961955845 3:130803311-130803333 GGGAGGAAACAAAGGAAGGGAGG - Intergenic
962278717 3:134034506-134034528 CAGAGAGAACAATGGCATGGAGG - Intronic
962513178 3:136123187-136123209 GAAAAGAAACAAAGGTATGGTGG + Intronic
962565022 3:136649114-136649136 TAGTATAAGCAAAGGCATGGAGG - Intronic
963299312 3:143581209-143581231 GAGTGTAAAGAAAGGCAAGGAGG + Intronic
963964986 3:151357587-151357609 GAGAGGGAAGAAAGGCAAGGAGG - Intronic
964577413 3:158188458-158188480 GAATGTAAACAAAAGCCTGGTGG - Intronic
965974930 3:174609661-174609683 AAGAGTATACAAAGAAATGGAGG + Intronic
966093258 3:176166111-176166133 AAGAGAAAACAAAGGCACAGAGG + Intergenic
967075158 3:185995217-185995239 CAGTGTAAACAAAGGCATAGAGG + Intergenic
967484550 3:190015435-190015457 GTGAGTAAACAGAGCCAAGGGGG - Intronic
967817783 3:193813842-193813864 GAGAATAAAGAAAGGCATGAGGG + Intergenic
967838818 3:193987217-193987239 GAAAGTAAAAAAAGGGAGGGAGG + Intergenic
969990291 4:11255128-11255150 AAGAGGAAACTAAGGCATAGTGG - Intergenic
971688302 4:29800153-29800175 GAAAGGAAACAAAGCCATAGTGG - Intergenic
971924731 4:32993435-32993457 GTGAGTATAAAATGGCATGGTGG - Intergenic
972269269 4:37494301-37494323 GAGAGCAAAAACAGACATGGAGG - Intronic
973798101 4:54449362-54449384 GAAACTAAACAAAGCCATGTAGG - Intergenic
975306742 4:72858062-72858084 GAGTGTTAACAGAGGCATGTAGG - Intergenic
976078014 4:81321320-81321342 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976942869 4:90727996-90728018 AAAAGTACACAAAGGCATTGAGG + Intronic
977359902 4:95988843-95988865 AAGAGTAAAAAAAGGCAAGGAGG - Intergenic
977878505 4:102177390-102177412 TAGAGGAAATATAGGCATGGTGG - Intergenic
978236280 4:106464963-106464985 GACAGTAGACAAAGGAATTGTGG + Intergenic
978450140 4:108823431-108823453 GAGAGTAAAGAAGGGAAAGGAGG + Intronic
978832368 4:113103940-113103962 GGAAGGAATCAAAGGCATGGAGG - Intronic
979024757 4:115555147-115555169 GAGTGTAAATAAAGTCAGGGAGG - Intergenic
979751184 4:124280852-124280874 AAGAGTAAACTTAGGGATGGAGG + Intergenic
980512395 4:133811962-133811984 GAAAGCAAACAAAAGCAGGGTGG + Intergenic
980888112 4:138785402-138785424 GAGTGTAAACAAAGTCCTGGGGG - Intergenic
981048703 4:140290433-140290455 GAGTGGAACCAAAGGCATGGGGG - Intronic
982149249 4:152434481-152434503 GGGGGTAAACTAAGGCATAGAGG - Intronic
982217451 4:153094736-153094758 GAGAGAAACCAAAAGCATAGTGG - Intergenic
982990182 4:162263766-162263788 GGGAGAAAACAAAGATATGGGGG - Intergenic
983057225 4:163112448-163112470 GAGAGGAAACACATGGATGGAGG + Intronic
984877935 4:184386022-184386044 GAAGGAAAACAAAGGCATTGGGG - Intergenic
986502343 5:8414374-8414396 GAGAGTCAGCAAAGGCAGGTAGG - Intergenic
986663164 5:10076971-10076993 GAGAATGAACTAGGGCATGGAGG - Intergenic
988111879 5:26832735-26832757 GACAGTAAACTTAGGCAAGGTGG + Intergenic
988242825 5:28635501-28635523 GAGAGACAACAAAGGTAAGGAGG - Intergenic
988660836 5:33266457-33266479 GAGAGGAAACAAAGGAACGATGG - Intergenic
989087916 5:37695418-37695440 GTGAGAAACCAAAGGCATGGTGG - Intronic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989502136 5:42179873-42179895 GAGAGGAAAGAGGGGCATGGAGG + Intergenic
991719648 5:69483377-69483399 AAGAAAAAACAAAGGCATGATGG + Intergenic
992657756 5:78927604-78927626 GATAGTAAAGAAAGGCTTAGAGG + Intronic
993476028 5:88365614-88365636 GAGAGCAAACAAAGGCTTCTGGG - Intergenic
993511483 5:88776634-88776656 GAGAGGAAAGAAAGGGAGGGAGG + Intronic
994024256 5:95063375-95063397 TACAGTAAACAAATCCATGGTGG + Intronic
994204359 5:97017416-97017438 GAGAGTAAAAAAAAGCAAGATGG - Intronic
996508993 5:124298184-124298206 GAGAGTAGGGAAAGGCATGAAGG + Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
998382193 5:141733712-141733734 CAGATTACACAAAGGCAAGGGGG + Intergenic
998549624 5:143064711-143064733 GAAAGTAAGCAAAGGTCTGGCGG - Intronic
998883911 5:146674503-146674525 GACAGTACACAAAGGGATGTAGG - Intronic
1000749459 5:165075367-165075389 GAGAGTAAGGAAAAGCATGGTGG - Intergenic
1000914591 5:167064896-167064918 GAGAGTAACGAAAGGGATGAAGG + Intergenic
1000965923 5:167656445-167656467 GACAGTGAGCAAAGGCATGGTGG + Intronic
1001027031 5:168232998-168233020 GTGAGTGAAGAAAGGAATGGAGG - Intronic
1001419064 5:171573336-171573358 ATGAGAAAACAAAGGCATGGAGG + Intergenic
1001873832 5:175182189-175182211 GAGAGAAAGGAAAGGCTTGGGGG - Intergenic
1002064268 5:176644256-176644278 CAGTGTAAGCAAAGGCTTGGAGG + Intronic
1002890447 6:1327124-1327146 GAGAGGCAAGGAAGGCATGGTGG + Intergenic
1002951133 6:1812506-1812528 CAGAGGAAAGAAAGGCAAGGGGG + Intronic
1003000802 6:2330981-2331003 AAAAGAAAACAGAGGCATGGTGG - Intergenic
1003122913 6:3332927-3332949 GAGATTAAACCAGGGCATGAAGG - Intronic
1003354114 6:5350044-5350066 GAAAGTAAAGAAAGGGGTGGGGG - Intronic
1003486561 6:6585112-6585134 GAGAAAAAAGAAAGGCCTGGAGG - Intergenic
1003778912 6:9400569-9400591 TGGCATAAACAAAGGCATGGAGG - Intergenic
1004121281 6:12824614-12824636 GGTAGTGAAGAAAGGCATGGAGG + Intronic
1004588355 6:17025235-17025257 TAGAGGAAAGAAAGGCTTGGGGG + Intergenic
1005325049 6:24691987-24692009 GAGACTAAACATGGGGATGGTGG + Intronic
1006394964 6:33781495-33781517 GAGAAAAAAGAAAGGCAGGGAGG + Intronic
1006972869 6:38065016-38065038 GAGAGCAAAGAAAAGCAGGGAGG + Intronic
1007041504 6:38726617-38726639 GTGAGTGAGCAAAGCCATGGTGG + Intronic
1007166271 6:39831032-39831054 ATGAGTAAACTAAGGCATGTGGG + Intronic
1007228760 6:40333485-40333507 GTGAGGAAACTGAGGCATGGGGG - Intergenic
1007506286 6:42337726-42337748 TAGCATAAGCAAAGGCATGGAGG + Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1010598459 6:77794122-77794144 GATAGTAAATAAAGGAATGCAGG + Intronic
1010767645 6:79794674-79794696 GTGAGGAAACTAAGGCATTGAGG + Intergenic
1011339654 6:86299875-86299897 GAGAGGAAAAAAAGGCAGAGAGG + Intergenic
1011388601 6:86825100-86825122 CATAGTAAACGAAGGCATTGAGG + Intergenic
1012074184 6:94662765-94662787 ATCAGTAAACAAAGGCATAGTGG + Intergenic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1014890913 6:126845132-126845154 CAGAGTGAGCAAAGGCATTGAGG + Intergenic
1015469699 6:133590193-133590215 GAGAGTAAAGAAAGGGCAGGAGG + Intergenic
1015946097 6:138502741-138502763 ATGAGCAAACCAAGGCATGGAGG - Intronic
1016952150 6:149590519-149590541 GAGAGAATAGAAAGGCATCGAGG - Intronic
1018003857 6:159602571-159602593 GAGACTAAACAAGAGCAGGGAGG + Intergenic
1018804298 6:167246986-167247008 GAGAGTTAGCAAAAGCATGCAGG - Intergenic
1018906404 6:168078733-168078755 GGGAGTAAACAGAGCCATGGGGG - Intronic
1019635547 7:2073704-2073726 GAGGGTAGACAGAGGCATAGGGG + Intronic
1020266347 7:6562841-6562863 GAGAGGAAAAAACGGCATGGCGG - Intergenic
1022211798 7:28218083-28218105 GAAAGTAAAGAAGGGCAGGGTGG + Intergenic
1022381198 7:29861488-29861510 AAGAGAAAACAAAGGAAAGGAGG - Intronic
1023105098 7:36756092-36756114 GGGGGTAAACAAAGGCAAAGAGG + Intergenic
1023665155 7:42515173-42515195 GTGAATAAACAAAGCCAAGGAGG - Intergenic
1024644908 7:51362886-51362908 GATAGTAAAGATAGTCATGGTGG - Intergenic
1024983942 7:55180019-55180041 GACAGGAGACAAAGGCAAGGTGG - Intronic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1027850696 7:83447753-83447775 GCCAGTAAACAAAGGCACAGTGG + Intronic
1028028244 7:85874427-85874449 GAGAGTCAACAAGAGCAAGGAGG - Intergenic
1028545143 7:91990807-91990829 GAAAGTAAAAACAGGGATGGGGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029514170 7:101015729-101015751 GAGGGTGAAGAAAGGCAGGGCGG + Intronic
1030695447 7:112580380-112580402 GAGTGGAAACAAAGGAATGTGGG - Intergenic
1030707734 7:112712174-112712196 GAAAGCAAACACAGGCCTGGAGG - Intergenic
1030715821 7:112805672-112805694 GAGAGCAAACAAAGGAAGAGAGG - Intergenic
1030888267 7:114965255-114965277 AAGAGAAAACAATGGCATAGGGG + Intronic
1030911027 7:115249354-115249376 GAGAGTACACAAAGCCAGGCAGG - Intergenic
1032238433 7:130143061-130143083 GAGAGTGAGCAAAGGCACAGTGG - Intergenic
1033664205 7:143425156-143425178 GAGAGAAAGAAAAAGCATGGGGG - Intergenic
1034037480 7:147839511-147839533 GTGAGTAAAGAAAGCCATGAAGG + Intronic
1036590700 8:10165486-10165508 GAGACTAAAGACAGGCAAGGGGG + Intronic
1036598564 8:10238238-10238260 GACTGCAAACAAAGCCATGGAGG - Intronic
1038507276 8:28095420-28095442 AAGAGGAAAATAAGGCATGGAGG - Intronic
1038865994 8:31439473-31439495 AAGAGAAGACAAAGGCATGAGGG + Intergenic
1039848248 8:41341548-41341570 GAAAGGAGAAAAAGGCATGGAGG + Intergenic
1041243846 8:55872534-55872556 GAGTGAAAACAAAGGCATAAAGG + Intergenic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1041957758 8:63575149-63575171 GAGAGTAAAAGAAGGAGTGGAGG - Intergenic
1043032703 8:75157398-75157420 GAACCTAAACAAAAGCATGGTGG - Intergenic
1043428968 8:80175931-80175953 GGTAGTAAACAAAGGGATGAAGG + Intronic
1043876152 8:85489080-85489102 GAAAGTCAACAAAGAAATGGTGG - Intergenic
1044451174 8:92336764-92336786 GAGAACAAAGAAAAGCATGGTGG - Intergenic
1044490332 8:92805976-92805998 GAGAGAGAACAATGCCATGGAGG + Intergenic
1044502730 8:92978295-92978317 GGGAGTAAACAAATGCATAAGGG - Intronic
1045042650 8:98241285-98241307 GAGAGTAGACAAACACATAGGGG + Intronic
1045237925 8:100372366-100372388 AAGAGTAAAGCCAGGCATGGTGG - Intronic
1045726494 8:105179465-105179487 GTGGGTAAAGAAATGCATGGAGG - Intronic
1045901068 8:107280601-107280623 TAGCATAAACAAAGGCATGGAGG + Intronic
1046657786 8:116913511-116913533 GAGAGTGAGGAAAGGCAGGGTGG - Intergenic
1046832412 8:118761202-118761224 GAGAGTACACAAAGTCAAGGTGG - Intergenic
1047336427 8:123940890-123940912 GAGGGGAAGGAAAGGCATGGAGG + Intronic
1048044518 8:130760519-130760541 GCGAGTAAACAAAGACACGGTGG + Intergenic
1049267441 8:141676353-141676375 AAGTGGAAACAAAGGCTTGGAGG + Intergenic
1049349033 8:142154273-142154295 GAAAGTAAATAAAGGAAGGGAGG - Intergenic
1050563109 9:6854924-6854946 GAGAGAAAATTGAGGCATGGAGG - Intronic
1051138708 9:13953929-13953951 GAGAGTAAAAGAAGGCAAGATGG - Intergenic
1051361126 9:16282696-16282718 GAGAGCCCACAAAGCCATGGAGG + Intergenic
1051568736 9:18530595-18530617 GAAACTAAGCAAAGGCATAGAGG - Intronic
1054853296 9:69871236-69871258 AATAATAAACAAAGGCAGGGAGG + Intronic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1055842794 9:80526232-80526254 GAGAATAAAGAAAAGCATAGCGG + Intergenic
1057196027 9:93115943-93115965 GAGAGTGAAGGAGGGCATGGGGG + Intergenic
1057408892 9:94799011-94799033 GAGAGTAAGAAAATGGATGGAGG - Intronic
1059341159 9:113598344-113598366 GAGGGGAAACAAAGGCACAGTGG - Intergenic
1060880843 9:127116960-127116982 GAGAGCACCCAAAGGCAGGGAGG - Intronic
1061285127 9:129618308-129618330 GGGAGAAAACTAAGGGATGGAGG - Intronic
1062251140 9:135594737-135594759 GAGAGAAAACATAGGCATCAAGG + Intergenic
1186176430 X:6930122-6930144 GAGAGAAGACAAAGACAAGGTGG + Intergenic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1190134012 X:47777817-47777839 GAGAATCAACAAAGTCATGCAGG - Intergenic
1190823976 X:53999985-54000007 GAGTGTCAACAAAGCCATGCAGG + Intronic
1192226098 X:69229054-69229076 GAGCATAGACAAAGGCATGGAGG + Intergenic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1194121277 X:89966163-89966185 GAGAGCAAACAAAGGCTCTGAGG + Intergenic
1194183027 X:90737185-90737207 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1194445071 X:93976526-93976548 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1195702806 X:107717390-107717412 GAGAGCATGCAAAGCCATGGGGG - Intronic
1195870215 X:109477937-109477959 GAGAGTCAAGAAAGTCTTGGGGG + Intronic
1197106656 X:122724713-122724735 GAGAGTATGAAAAGGCATGTGGG - Intergenic
1197155218 X:123263029-123263051 GGCAGTAAACAAAGGGAGGGAGG + Intronic
1197356655 X:125444432-125444454 GAGAGCAAGGAAAAGCATGGTGG + Intergenic
1197758969 X:130014697-130014719 GGGGGTCAACACAGGCATGGGGG - Exonic
1198387229 X:136141000-136141022 GAGAGAGAAGAGAGGCATGGTGG + Intergenic
1199035914 X:143050792-143050814 GAGAGTGAACATAAGCAGGGTGG - Intergenic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1200166684 X:154040428-154040450 GAGAGAAAACAAGGGGGTGGGGG + Intronic
1200474134 Y:3623614-3623636 GAGAGCAAACAAAGGCTCTGAGG + Intergenic
1200529645 Y:4319139-4319161 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1202303759 Y:23445859-23445881 GAGAATAAAAAAAAGTATGGAGG + Intergenic
1202350598 Y:23986277-23986299 GTGAGGAAATACAGGCATGGTGG - Intergenic
1202520181 Y:25683844-25683866 GTGAGGAAATACAGGCATGGTGG + Intergenic
1202567051 Y:26224734-26224756 GAGAATAAAAAAAAGTATGGAGG - Intergenic