ID: 1123009503

View in Genome Browser
Species Human (GRCh38)
Location 14:105340946-105340968
Sequence TAGCCGTCACCCAGCTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123009495_1123009503 24 Left 1123009495 14:105340899-105340921 CCTAGTGGGGCTGCTTGCTCAGC 0: 1
1: 0
2: 3
3: 15
4: 171
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1123009501_1123009503 -8 Left 1123009501 14:105340931-105340953 CCGTCTCTGGCCACGTAGCCGTC 0: 1
1: 0
2: 1
3: 7
4: 87
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1123009497_1123009503 0 Left 1123009497 14:105340923-105340945 CCCTTGCCCCGTCTCTGGCCACG 0: 1
1: 0
2: 0
3: 19
4: 250
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1123009500_1123009503 -7 Left 1123009500 14:105340930-105340952 CCCGTCTCTGGCCACGTAGCCGT 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1123009498_1123009503 -1 Left 1123009498 14:105340924-105340946 CCTTGCCCCGTCTCTGGCCACGT 0: 1
1: 0
2: 0
3: 27
4: 275
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1123009499_1123009503 -6 Left 1123009499 14:105340929-105340951 CCCCGTCTCTGGCCACGTAGCCG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1123009493_1123009503 26 Left 1123009493 14:105340897-105340919 CCCCTAGTGGGGCTGCTTGCTCA 0: 1
1: 0
2: 2
3: 26
4: 407
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50
1123009494_1123009503 25 Left 1123009494 14:105340898-105340920 CCCTAGTGGGGCTGCTTGCTCAG 0: 1
1: 0
2: 1
3: 15
4: 139
Right 1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123009503 Original CRISPR TAGCCGTCACCCAGCTAGCA TGG Intronic
900400198 1:2469887-2469909 GGGTCTTCACCCAGCTAGCATGG - Intronic
915062696 1:153199382-153199404 TGGCCAACACCCAGCCAGCAGGG + Intergenic
921277241 1:213532367-213532389 TAGCCCGCACCCAGCTGGCTGGG + Intergenic
1063012619 10:2040328-2040350 TAGCAGTGACCCAGGCAGCACGG - Intergenic
1064166268 10:12988950-12988972 TAGCCTTCACCTAGAAAGCAGGG + Intronic
1069599706 10:69695717-69695739 GAGCAGTCACACAGCTAGCCGGG - Intergenic
1070775036 10:79104497-79104519 TAGACGTCACTGAGCTTGCAGGG + Intronic
1074431604 10:113399492-113399514 TATCCGTCACCCACCTTGCCTGG - Intergenic
1075521280 10:123145123-123145145 TAGCCGTCACACCGCAAGGACGG - Intergenic
1077303776 11:1858825-1858847 TAGCCGTGTCCCACCCAGCACGG + Intronic
1082926453 11:58552381-58552403 TAGCAGTCGCCCAGCTGGAAAGG - Intronic
1084370493 11:68739061-68739083 TAGCTGTCACTCAGCTGGCCAGG + Intronic
1085793909 11:79519596-79519618 GAGAAGTCACCCAGCTAGGAAGG + Intergenic
1094324033 12:29217208-29217230 TAGCATTCACCCATCTAGAAAGG - Intronic
1100526996 12:95428881-95428903 TAGCGGTCATCAAGATAGCATGG + Intergenic
1118593137 14:67416295-67416317 TGGCCGTCCCCCAGGTAGCAGGG - Intergenic
1123009503 14:105340946-105340968 TAGCCGTCACCCAGCTAGCATGG + Intronic
1130541061 15:84821159-84821181 TAGCTGTGGCCCAGCCAGCAGGG + Intronic
1131978187 15:97967069-97967091 CAGCCGGCACCCAGCTGGCCTGG + Intronic
1132006238 15:98230059-98230081 TTGCCGTCACACATCTAACAGGG + Intergenic
1132658894 16:1052923-1052945 CAGCTGTCACCCAGCTGACACGG + Intergenic
1136615581 16:31396355-31396377 TTTCAGTCACCCAGCTAGCTGGG - Intronic
1141290800 16:82716615-82716637 AAGCAGACACCCAGCTGGCATGG + Intronic
1141766313 16:86062043-86062065 AAGAGGTCACCCAGCTAGCAGGG - Intergenic
1146930842 17:36776839-36776861 TAGCCATCACCCAGGGAGAATGG - Intergenic
1150846184 17:68660564-68660586 AACCCATCACCCAGCTATCAAGG - Intergenic
1153172519 18:2332508-2332530 TGGCTGTCACCCACCTAGTATGG + Intergenic
1155381067 18:25223352-25223374 TAGCCATCAGTCAGCTGGCAGGG - Intronic
1157302637 18:46490276-46490298 TTGCAGTCACCCAGATCGCAGGG + Intronic
1157428422 18:47603327-47603349 TAACAGTCACACAGCTAACAGGG - Intergenic
1160479349 18:79224635-79224657 AAGCCAGCAGCCAGCTAGCAGGG + Intronic
924985793 2:268490-268512 GAGCCATGACCCAGCCAGCATGG + Intronic
942095818 2:172535714-172535736 TGGCCTTCACCCATGTAGCAGGG - Intergenic
948438771 2:237971983-237972005 CAACCGTCTCCCAGATAGCAAGG + Intronic
948494644 2:238339541-238339563 TAGCCCCCACCCAGCTAGCTAGG + Intronic
1171115806 20:22523952-22523974 CAGCCCTCACCTAGCTATCAAGG - Intergenic
1172891874 20:38271412-38271434 TAGAGCTCACCCAGCCAGCAAGG - Intronic
1175553287 20:59830802-59830824 ACGCCATCACCCAGCTGGCAGGG + Intronic
1181897661 22:26125082-26125104 TCGAGGTCACACAGCTAGCAAGG + Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
969429126 4:7143683-7143705 AGGCCGTCACCCAGCTTTCAAGG + Intergenic
981926033 4:150140353-150140375 TAGGCCTCCCCCAGCAAGCATGG + Intronic
993664561 5:90679794-90679816 TTGTAGTCACCCAGCTAGTAAGG + Intronic
994051324 5:95365773-95365795 CAGCCCTCACCCAGCTCCCACGG + Intergenic
999479922 5:151938627-151938649 TTGCCTGCACCCAGCTAGTAAGG + Intergenic
1010580889 6:77595009-77595031 TAGCCCTCACCCTGCTAGTCAGG + Intergenic
1013457993 6:110349376-110349398 TGGCAGTCACACTGCTAGCATGG + Intronic
1031675767 7:124610242-124610264 TAGCTCTCACGCAGCCAGCAAGG - Intergenic
1049219187 8:141421139-141421161 TAGCCACCACACAGCCAGCAGGG - Intronic
1049795992 8:144497499-144497521 GAGACGGCACCCAGGTAGCAGGG - Intronic
1060442366 9:123653943-123653965 TAAAGGTCACCCAGCTAGAAAGG + Intronic
1061368607 9:130185569-130185591 AAGCCGCCAGCCAGCCAGCAAGG + Intronic
1190374757 X:49778018-49778040 CAACCTTCACCAAGCTAGCATGG - Intergenic
1193852842 X:86560489-86560511 TAGCCTTCCCCAATCTAGCAAGG - Intronic