ID: 1123014591

View in Genome Browser
Species Human (GRCh38)
Location 14:105367733-105367755
Sequence CCCCGCCTGAGGAGTAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123014591_1123014598 -10 Left 1123014591 14:105367733-105367755 CCTCCCCTACTCCTCAGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1123014598 14:105367746-105367768 TCAGGCGGGGGAGACCCAGTCGG 0: 1
1: 0
2: 0
3: 10
4: 151
1123014591_1123014607 27 Left 1123014591 14:105367733-105367755 CCTCCCCTACTCCTCAGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1123014607 14:105367783-105367805 GAAATGCCAGCTGGCAGGAGGGG 0: 1
1: 0
2: 1
3: 31
4: 335
1123014591_1123014602 18 Left 1123014591 14:105367733-105367755 CCTCCCCTACTCCTCAGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1123014602 14:105367774-105367796 ATCCAGGCTGAAATGCCAGCTGG 0: 1
1: 0
2: 3
3: 27
4: 204
1123014591_1123014606 26 Left 1123014591 14:105367733-105367755 CCTCCCCTACTCCTCAGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1123014606 14:105367782-105367804 TGAAATGCCAGCTGGCAGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 362
1123014591_1123014599 2 Left 1123014591 14:105367733-105367755 CCTCCCCTACTCCTCAGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1123014599 14:105367758-105367780 GACCCAGTCGGTGCAAATCCAGG 0: 1
1: 0
2: 2
3: 0
4: 54
1123014591_1123014605 25 Left 1123014591 14:105367733-105367755 CCTCCCCTACTCCTCAGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1123014605 14:105367781-105367803 CTGAAATGCCAGCTGGCAGGAGG 0: 1
1: 0
2: 1
3: 37
4: 427
1123014591_1123014604 22 Left 1123014591 14:105367733-105367755 CCTCCCCTACTCCTCAGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 162
Right 1123014604 14:105367778-105367800 AGGCTGAAATGCCAGCTGGCAGG 0: 1
1: 0
2: 2
3: 15
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123014591 Original CRISPR CCCCGCCTGAGGAGTAGGGG AGG (reversed) Intronic