ID: 1123018638

View in Genome Browser
Species Human (GRCh38)
Location 14:105387300-105387322
Sequence CATTCTCGGCAGAGGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 284}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123018638_1123018647 -1 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018647 14:105387322-105387344 GGCACTCCTCCTATGAGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1123018638_1123018653 13 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018653 14:105387336-105387358 GAGGGCAGGCCAGGCCTGGAGGG 0: 1
1: 2
2: 14
3: 76
4: 653
1123018638_1123018654 16 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018654 14:105387339-105387361 GGCAGGCCAGGCCTGGAGGGCGG 0: 1
1: 2
2: 6
3: 134
4: 949
1123018638_1123018645 -6 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018645 14:105387317-105387339 AGAATGGCACTCCTCCTATGAGG 0: 1
1: 0
2: 0
3: 18
4: 198
1123018638_1123018646 -5 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018646 14:105387318-105387340 GAATGGCACTCCTCCTATGAGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1123018638_1123018648 4 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018648 14:105387327-105387349 TCCTCCTATGAGGGCAGGCCAGG 0: 1
1: 0
2: 1
3: 13
4: 174
1123018638_1123018652 12 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018652 14:105387335-105387357 TGAGGGCAGGCCAGGCCTGGAGG 0: 1
1: 2
2: 31
3: 285
4: 1949
1123018638_1123018651 9 Left 1123018638 14:105387300-105387322 CCCGCCCTCCTCTGCCGAGAATG 0: 1
1: 0
2: 3
3: 44
4: 284
Right 1123018651 14:105387332-105387354 CTATGAGGGCAGGCCAGGCCTGG 0: 1
1: 0
2: 0
3: 31
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123018638 Original CRISPR CATTCTCGGCAGAGGAGGGC GGG (reversed) Intronic
900985991 1:6073013-6073035 CAGTCTCAGCAGAGGAGGTGAGG + Intronic
901549986 1:9989007-9989029 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
902667313 1:17948657-17948679 CATGCTCGGGAGAGGGTGGCGGG - Intergenic
902958226 1:19941601-19941623 CATTCTAGGCACTGGCGGGCTGG - Intergenic
904005170 1:27359818-27359840 CACCCTCAGCAGATGAGGGCGGG + Intronic
904163632 1:28538722-28538744 CACTCTGGGCAGAGCAGAGCAGG + Intronic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
907092631 1:51742038-51742060 AAATCTCGGGAGAGGAGGTCGGG + Intronic
907465980 1:54637238-54637260 TGGTCTCGGCAGAGGTGGGCGGG + Exonic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
909185667 1:72482218-72482240 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910400216 1:86830853-86830875 AATTCTAGGCCGAGGTGGGCGGG + Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
916859452 1:168787118-168787140 CATTCTAGGAAAAGCAGGGCGGG + Intergenic
917733312 1:177897810-177897832 CATTCTGGGCATGGCAGGGCTGG - Intergenic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
922957771 1:229618780-229618802 CACGGTCGGTAGAGGAGGGCTGG + Intronic
923306535 1:232693917-232693939 AATTCTGGGCAGAAGAGAGCGGG + Intergenic
1066281612 10:33923488-33923510 AATTCTAGGCAAAAGAGGGCGGG + Intergenic
1068321764 10:55427107-55427129 GATTCTGGGAAGATGAGGGCAGG - Intronic
1069020897 10:63487329-63487351 GATTCTCAACACAGGAGGGCTGG + Intergenic
1070918704 10:80170869-80170891 CATGCTGGGCGGAGGAGGGTAGG + Exonic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1073468373 10:103707862-103707884 ATTTCCCAGCAGAGGAGGGCAGG - Intronic
1076465126 10:130675068-130675090 CATTCTCAGCTGAGGAGGAAAGG + Intergenic
1077530392 11:3092273-3092295 CATGCTCGGCAGAGAAGGAAAGG + Intronic
1078663613 11:13306606-13306628 CATTCTGGGCAGAGGAATTCTGG + Intronic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1082645597 11:55720484-55720506 AATTCTAGGCAGACAAGGGCAGG - Intergenic
1084192033 11:67503792-67503814 CCTCCGCGGCAGAGGAAGGCGGG - Intronic
1084658161 11:70531415-70531437 CATGCTTGGCAGAGGTGAGCTGG + Intronic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1086559854 11:88154933-88154955 CAATCTCTGCACAGGAGGGGTGG - Intronic
1088568406 11:111197305-111197327 CTTTCTGGGCAGAGCAGGTCCGG + Intergenic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1089634846 11:119805458-119805480 CATTCAAAGCAGAGGAGGACAGG - Intergenic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1091566133 12:1649474-1649496 CATCGTAGGCAGAGGAGGGAGGG - Intergenic
1091642242 12:2246239-2246261 CAGGCTCGGCAGAGCTGGGCAGG + Intronic
1091988221 12:4931574-4931596 CAATCTCAGCAAAGGAGAGCAGG - Intergenic
1093268437 12:17027931-17027953 AATTCTAGACAGAAGAGGGCAGG + Intergenic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1094818165 12:34206014-34206036 CACTCTAGCCAGAGCAGGGCGGG + Intergenic
1095247442 12:39939353-39939375 CATTCTCATCAGAGGAGGCTTGG - Intronic
1099543803 12:83950724-83950746 AATTCTGGACAGAAGAGGGCGGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100594629 12:96061248-96061270 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1101330415 12:103753332-103753354 CCTTCTGGGCATAGGAGAGCTGG - Exonic
1101432771 12:104640818-104640840 AATTCTGGGCAGAAGAGGGTTGG + Intronic
1102634978 12:114315027-114315049 CATCCTCTGCCAAGGAGGGCTGG + Intergenic
1104265780 12:127231445-127231467 AATTCTGGGCAGAAAAGGGCAGG + Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1105639683 13:22249648-22249670 AATTCTGGGCAGAAGAGGGTAGG + Intergenic
1105771462 13:23616412-23616434 CATTAGCATCAGAGGAGGGCAGG + Intronic
1106400790 13:29428423-29428445 CATCCCCGCCAGGGGAGGGCTGG + Intronic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108524643 13:51276325-51276347 CATTCTCTGCATAGAATGGCAGG - Intronic
1110723360 13:78790767-78790789 AATTCTCTTCAGAGGAGGGAAGG - Intergenic
1111104718 13:83629934-83629956 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1111943720 13:94641266-94641288 CATTCCTGGCAGAGGAAGGTTGG + Intergenic
1112195919 13:97226177-97226199 TACTCTCAGCAGAGGAGGCCGGG - Intronic
1113010642 13:105761857-105761879 CCTTCTGGGCTGAGGAGAGCTGG + Intergenic
1113467856 13:110524757-110524779 GATTCTGGGCAGATAAGGGCAGG - Intronic
1114221254 14:20699440-20699462 CATCCTGGCCATAGGAGGGCTGG - Exonic
1114620720 14:24094537-24094559 CATCCTAGGCGGAGGCGGGCAGG + Intronic
1117348710 14:54859615-54859637 GATTCTCAGCAGATGAGGGCAGG + Intronic
1117903828 14:60564222-60564244 CTTTCTCAGATGAGGAGGGCAGG + Intergenic
1119001309 14:70884482-70884504 CATTCCTGGCAGAGAAGAGCAGG + Intergenic
1120491911 14:85189046-85189068 CATCCCTGACAGAGGAGGGCTGG + Intergenic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1122861150 14:104582898-104582920 CATGCTCGGCAGGTGGGGGCGGG - Intronic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123765206 15:23471165-23471187 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1125750101 15:42022023-42022045 CATCCTTGGCAGAGGAGGGGAGG - Intronic
1127410734 15:58703979-58704001 CATCCTCGATAGAGGAGGACTGG - Intronic
1128873984 15:71187055-71187077 CCTTTTCAGCAGAGGAAGGCGGG + Intronic
1129424534 15:75454402-75454424 CAGTCTGGGCCGAGGAGTGCAGG + Intronic
1131413659 15:92232587-92232609 CACTCTCAGCAGAGCAGGTCAGG - Intergenic
1131432863 15:92400717-92400739 CACTGTGGGCAGTGGAGGGCTGG - Intronic
1131814744 15:96211037-96211059 AACTCTGGGCAGAAGAGGGCAGG + Intergenic
1131931554 15:97448584-97448606 AATTCTGGGCGGAAGAGGGCAGG + Intergenic
1132705760 16:1242474-1242496 CTATCTGGGCAGGGGAGGGCTGG - Exonic
1133504040 16:6392915-6392937 CATTCATGGCAGAAGAGGGTGGG - Intronic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1136548022 16:30966169-30966191 CAGTCTCGGGAGAGGAGGCCCGG + Exonic
1136713450 16:32258664-32258686 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1136754461 16:32670767-32670789 CATTGTGGCCACAGGAGGGCAGG - Intergenic
1136813652 16:33199598-33199620 CATTGTGGCCACAGGAGGGCAGG + Intronic
1136820128 16:33309678-33309700 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1136826691 16:33366217-33366239 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1136831757 16:33464988-33465010 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1141179102 16:81740299-81740321 CATACTCTGTAGGGGAGGGCAGG - Intronic
1141227985 16:82137339-82137361 CATGATCGGGAGAGGAGGGAGGG + Intergenic
1141623086 16:85247511-85247533 CATGCTCCTCAGAGGAGGCCTGG + Intergenic
1202992228 16_KI270728v1_random:22572-22594 CATTGTGGCCACAGGAGGGCAGG + Intergenic
1203056608 16_KI270728v1_random:931098-931120 CATTGTGGCCACAGGAGGGCAGG - Intergenic
1142801090 17:2346313-2346335 GGTTCTTGGCAGAGGAGGGTTGG + Intronic
1143964744 17:10749080-10749102 CTTTCTCGGCAGGGGAGTTCCGG + Intergenic
1144050571 17:11494283-11494305 CATTAACAGCAGAGGAGAGCTGG - Intronic
1146960065 17:36966758-36966780 CTTTCTTGGCAGGGGAGGGGAGG + Intronic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1148537716 17:48454840-48454862 AATTCTCGGCAGAAAAGGGCAGG + Intergenic
1148865754 17:50627725-50627747 CCTTCACGGCTGGGGAGGGCAGG - Intergenic
1149018532 17:51936516-51936538 CAGTCTTGGCAGAGAAGAGCTGG + Intronic
1152038382 17:77887490-77887512 CACTCTTGGCGGGGGAGGGCGGG + Intergenic
1155045137 18:22096648-22096670 CATTCTGGGCACTGGGGGGCAGG + Intronic
1155186308 18:23389648-23389670 CCTACTCGGCAGAGTGGGGCAGG - Intronic
1156036578 18:32771971-32771993 GCATCTAGGCAGAGGAGGGCAGG + Intronic
1158159581 18:54465704-54465726 AATTCTGGACAGAAGAGGGCAGG - Intergenic
1159030584 18:63226395-63226417 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1159777551 18:72620704-72620726 AATTCTAGGCAGACGAGGGTAGG - Intronic
1162342371 19:10099210-10099232 GATTCAGGGCAGAGGAGGGAGGG - Intronic
1163701673 19:18789537-18789559 CATCCCCAGCAGAGGGGGGCAGG + Intronic
1165013085 19:32862917-32862939 CATCCCCGATAGAGGAGGGCTGG - Intronic
1165300800 19:34967533-34967555 AATTCTGGGCAGAAGAGGCCAGG + Intergenic
1165803692 19:38567761-38567783 CATTCTCGGCACTGCAGGGCAGG - Exonic
1167135474 19:47612946-47612968 AATTCTCGGGGGAGGTGGGCAGG + Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925232067 2:2242247-2242269 CAATCTCTGCAAAGGAGCGCAGG + Intronic
925920839 2:8636765-8636787 GATTCTGGGCAGAGGAGTTCTGG - Intergenic
925965277 2:9059931-9059953 CTTTCTGGGAAGAGCAGGGCAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
927261228 2:21093150-21093172 CTTTCTTGGCAGAGGACTGCGGG - Intergenic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
929906926 2:46054660-46054682 AATTCGGGGCAGAAGAGGGCAGG + Intronic
929945718 2:46370342-46370364 CATTCACAGAAGAGGAGGGCAGG + Intronic
930062761 2:47304348-47304370 CATTGTTGGCTGAGGAGGGAAGG + Intergenic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
932556495 2:72829506-72829528 AATTCTGGGCAGAGGAGCACAGG + Intergenic
933699751 2:85245961-85245983 CTTTCTGGGCAAAGGAGAGCTGG - Intronic
933747496 2:85581794-85581816 CATTCTCTGTAGAGGAAGACAGG - Exonic
933981548 2:87554870-87554892 CATTCTCTGAAGATGGGGGCAGG - Intergenic
935250984 2:101260471-101260493 CAATCTGGGTAGAGGACGGCAGG - Intronic
936312288 2:111395946-111395968 CATTCTCTGAAGATGGGGGCAGG + Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
936858352 2:116987044-116987066 AATTCTGGGCAGACAAGGGCGGG + Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
938787830 2:134648506-134648528 AATTCTGGGCAGAAGAGGGTGGG - Intronic
938860070 2:135359015-135359037 CTTTCTGGGATGAGGAGGGCAGG - Intronic
940418985 2:153456241-153456263 CACTCTAGGCAGAAAAGGGCGGG - Intergenic
941427647 2:165368459-165368481 AATTCTGGGCAGAAGAGGACGGG - Intronic
942493658 2:176516214-176516236 CTTTCTTGGGAGAGCAGGGCAGG + Intergenic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
945113628 2:206389367-206389389 CTTTCTGGGAAGAGTAGGGCAGG + Intergenic
946170281 2:217891187-217891209 GCTTCTCGGCACAGGATGGCAGG - Intronic
946216009 2:218184092-218184114 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
946411686 2:219518359-219518381 CATTCTGGGTGGAGGAGAGCTGG + Intronic
948911082 2:241003013-241003035 CACTCTGCACAGAGGAGGGCAGG - Intronic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1170905788 20:20514438-20514460 GGATCTCGGCAGAGGAGGGATGG - Intronic
1171005871 20:21465386-21465408 CATCCTGGGAAGAGGATGGCAGG - Intergenic
1171206264 20:23283576-23283598 CTTTCTGGGCAAGGGAGGGCAGG + Intergenic
1171274579 20:23845237-23845259 CAATCTCTGCAGAGGAAGGTTGG - Intergenic
1176430990 21:6575514-6575536 CCATCTCACCAGAGGAGGGCTGG + Intergenic
1176695551 21:9972797-9972819 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177294774 21:19160380-19160402 CAATCTCTGCACAGGAGGGATGG + Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1179706384 21:43182976-43182998 CCATCTCACCAGAGGAGGGCTGG + Intergenic
1180935380 22:19622039-19622061 AATCCGCGGCAGAGGAGGGCAGG - Intergenic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1183705214 22:39471598-39471620 CCATCTCTGCAGAGGAAGGCCGG - Intronic
1183788077 22:40043357-40043379 CATTTCAGCCAGAGGAGGGCAGG - Exonic
1185086921 22:48745890-48745912 CACACGCGTCAGAGGAGGGCGGG + Intronic
1185098401 22:48824133-48824155 CGCTCTCTGCAGAGAAGGGCGGG + Intronic
1185219099 22:49620221-49620243 CACACGCGGCAGAGGAGAGCTGG - Intronic
949227462 3:1711545-1711567 GATTCTAGGCAGACAAGGGCAGG - Intergenic
949956708 3:9275060-9275082 AACTCTGGGCAGAAGAGGGCAGG - Intronic
950016881 3:9760734-9760756 CATTCTCGTCATAGAAGGGAGGG + Exonic
950978857 3:17280313-17280335 AATTCTGGACAGAAGAGGGCAGG + Intronic
951098089 3:18654957-18654979 CATTTTAGTCACAGGAGGGCAGG - Intergenic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
953884960 3:46709919-46709941 CTGTCTCGGCAGAGGTGGTCTGG + Exonic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
954760521 3:52870576-52870598 CACCCTGGGCAGAGGATGGCAGG - Intronic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
957824534 3:85423278-85423300 CATTATGGGCAGGGGAGGGGTGG + Intronic
958467387 3:94474022-94474044 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
958996617 3:100913001-100913023 CAGTCTAGGCAGAGGCGGGCAGG + Intronic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961649941 3:128412331-128412353 GCTGCTCGGCAGAGGAGGCCAGG - Intergenic
962250722 3:133834450-133834472 CATTCGCGGCAGACCAGGGAAGG + Intronic
963409669 3:144911514-144911536 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
966059182 3:175734256-175734278 AAATCTAGGCAGAGGTGGGCTGG + Intronic
966993118 3:185254165-185254187 GGGTCTCGGGAGAGGAGGGCTGG - Intronic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968359693 3:198138397-198138419 CACGCTCGTCAGAGAAGGGCTGG + Intergenic
971427422 4:26530226-26530248 AGTTCTGGGCAGACGAGGGCAGG + Intergenic
972066488 4:34952830-34952852 AATTCTAGGCAGACAAGGGCAGG + Intergenic
973840051 4:54852220-54852242 CAGGCAAGGCAGAGGAGGGCGGG - Intergenic
974763950 4:66316143-66316165 TTTTCTAGGCAGAGTAGGGCAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
980368177 4:131833045-131833067 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
982786678 4:159544392-159544414 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
982798536 4:159673797-159673819 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984171764 4:176368247-176368269 CAATCTCTGCAGAGGAAGGGTGG + Intergenic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
985972841 5:3391875-3391897 CATTCTCAGCAAAGGTGAGCTGG - Intergenic
988350861 5:30106028-30106050 AATTCTGGGCTGAAGAGGGCAGG + Intergenic
992229978 5:74654575-74654597 CTTTCTAGGCAGATGAGGGAAGG + Intronic
992903957 5:81326704-81326726 CTCTCTGGGCAGAGGAGGCCTGG - Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
999277958 5:150344558-150344580 CATCATCGGCAGAGCTGGGCTGG - Intergenic
999851177 5:155541365-155541387 AATTCTAGGCAGAAGAGGACGGG + Intergenic
1002457378 5:179353284-179353306 CCTTCTCCTCAGAAGAGGGCTGG - Intergenic
1004495192 6:16156307-16156329 AATTCTGGGCAGAAGAGGTCGGG - Intergenic
1004513671 6:16303437-16303459 CATTCTGGCCAGAGCAGGGCTGG - Exonic
1007460745 6:42017051-42017073 CTCACCCGGCAGAGGAGGGCAGG + Intronic
1007755140 6:44094581-44094603 CATTCCAGGTAGAGAAGGGCAGG + Intergenic
1007931985 6:45700019-45700041 AATACTGGGCAGAAGAGGGCAGG + Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1009936654 6:70242186-70242208 TATTCTCAGGAGAAGAGGGCGGG + Intronic
1011899590 6:92275431-92275453 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1013492396 6:110660931-110660953 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1013658956 6:112275073-112275095 CATTCTCAGAAGAGCAGAGCTGG - Intergenic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1016568971 6:145491700-145491722 AATTCTGGGCAAAGGAGGACAGG - Intergenic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1018185570 6:161263092-161263114 TATTCTCGGCGGCGGTGGGCGGG + Intronic
1019260296 7:78253-78275 CACGCTCGTCAGAGAAGGGCTGG - Intergenic
1019912125 7:4107004-4107026 CATCCAGGCCAGAGGAGGGCAGG + Intronic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1020739133 7:11990702-11990724 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1021647664 7:22802265-22802287 CATTGAAGGCTGAGGAGGGCTGG - Intergenic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1022591758 7:31670680-31670702 AATTCTGGGCAGAAGAGAGCAGG + Intergenic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026831184 7:73611159-73611181 AATTGTGGGCAGAGGAGGGAAGG - Intronic
1026919449 7:74144463-74144485 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1030546933 7:110907615-110907637 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1032248426 7:130232432-130232454 AATTCTGGGCAGAAAAGGGCAGG - Intergenic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1033605661 7:142926527-142926549 CATGCTCGGCAGTGTAGGGCAGG + Intronic
1034102181 7:148459315-148459337 CATCCTGACCAGAGGAGGGCAGG + Intergenic
1034406373 7:150905522-150905544 CTCTCTCAGCAGAGGAGGCCTGG + Intergenic
1034973898 7:155436836-155436858 CATTCCAGCCAGAGAAGGGCAGG - Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037901685 8:22692567-22692589 CCTTCTCGATCGAGGAGGGCGGG + Intronic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1041260436 8:56016931-56016953 CAGTCAGGGCGGAGGAGGGCAGG + Intergenic
1041398001 8:57411494-57411516 CTTTCTGGGAAGAGGAGGACAGG - Intergenic
1042004359 8:64165247-64165269 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1043078015 8:75727114-75727136 TTTTCTAGGCAAAGGAGGGCTGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1049523663 8:143108984-143109006 CCATCGCGGAAGAGGAGGGCAGG - Intergenic
1050944348 9:11499028-11499050 AATTCTGGGCAGAAGAGGACAGG + Intergenic
1052465832 9:28828908-28828930 AATTCTGGGCAGAGGAGGATGGG + Intergenic
1052518746 9:29515155-29515177 CGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1053382706 9:37661874-37661896 CATCCCCGACAGAGGAGGACTGG - Intronic
1053416452 9:37949831-37949853 CATGCATGCCAGAGGAGGGCAGG + Intronic
1053545418 9:39018138-39018160 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053632534 9:39958748-39958770 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1053773226 9:41504783-41504805 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1053809748 9:41839836-41839858 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1054211354 9:62291949-62291971 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1054313629 9:63556903-63556925 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1054620845 9:67347592-67347614 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056816786 9:89807636-89807658 TTTTGTGGGCAGAGGAGGGCAGG + Intergenic
1057416398 9:94867337-94867359 CACTCTCGGCCGAGGTGGCCTGG + Intronic
1057744631 9:97741406-97741428 CCTGCCCGGCAGAGGCGGGCGGG - Intergenic
1058566990 9:106296606-106296628 AATTCTTGGCAGAGGAGCGTGGG + Intergenic
1059732864 9:117074031-117074053 TATTCCCGGCAGGTGAGGGCCGG - Intronic
1060524568 9:124313243-124313265 GAGCCTGGGCAGAGGAGGGCCGG + Intronic
1061044291 9:128156304-128156326 CACTCTCAGCCAAGGAGGGCAGG + Intergenic
1061679690 9:132236808-132236830 GATTCTGGGCAGTGGAAGGCAGG + Intronic
1062220608 9:135413239-135413261 CCTTCTCGGAAGAGGAGGGGAGG - Intergenic
1062744399 9:138202218-138202240 CACGCTCGTCAGAGAAGGGCTGG + Intergenic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1186033268 X:5392613-5392635 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1186087095 X:6002626-6002648 AATTCTGGGCAGAAGAGAGCGGG + Intronic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1186610483 X:11133860-11133882 ACATCTCTGCAGAGGAGGGCTGG + Intergenic
1187469170 X:19552983-19553005 CATGCTGGGCTGAGGAGTGCTGG + Intronic
1188182350 X:27072261-27072283 AATTCTGGGCACAAGAGGGCAGG + Intergenic
1188553206 X:31383503-31383525 AATTCTGGACAGAAGAGGGCGGG + Intronic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194878902 X:99225636-99225658 AATTCCTGGCAGAAGAGGGCAGG + Intergenic
1196300713 X:114047411-114047433 AATTTTGGGCAGAAGAGGGCAGG + Intergenic
1196395962 X:115261814-115261836 AATTCTGGGCAGAAGAGAGCAGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1199860936 X:151800057-151800079 CAAGCTGGGCAAAGGAGGGCTGG - Intergenic
1200074589 X:153544811-153544833 CATTGCTGGAAGAGGAGGGCTGG - Intronic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic