ID: 1123019084

View in Genome Browser
Species Human (GRCh38)
Location 14:105389222-105389244
Sequence CGGGCTGTGACCAGACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123019072_1123019084 19 Left 1123019072 14:105389180-105389202 CCCCGCGGCTCCTGTCCTCCACC 0: 1
1: 0
2: 1
3: 27
4: 295
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019071_1123019084 28 Left 1123019071 14:105389171-105389193 CCTCAGCGGCCCCGCGGCTCCTG 0: 1
1: 0
2: 4
3: 17
4: 306
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019077_1123019084 4 Left 1123019077 14:105389195-105389217 CCTCCACCCTTGGCATCTTCGTG 0: 1
1: 0
2: 0
3: 16
4: 200
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019070_1123019084 29 Left 1123019070 14:105389170-105389192 CCCTCAGCGGCCCCGCGGCTCCT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019074_1123019084 17 Left 1123019074 14:105389182-105389204 CCGCGGCTCCTGTCCTCCACCCT 0: 1
1: 1
2: 3
3: 59
4: 608
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019078_1123019084 1 Left 1123019078 14:105389198-105389220 CCACCCTTGGCATCTTCGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 86
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019081_1123019084 -3 Left 1123019081 14:105389202-105389224 CCTTGGCATCTTCGTGTGGACGG 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019080_1123019084 -2 Left 1123019080 14:105389201-105389223 CCCTTGGCATCTTCGTGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019073_1123019084 18 Left 1123019073 14:105389181-105389203 CCCGCGGCTCCTGTCCTCCACCC 0: 1
1: 0
2: 4
3: 49
4: 437
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019069_1123019084 30 Left 1123019069 14:105389169-105389191 CCCCTCAGCGGCCCCGCGGCTCC 0: 1
1: 0
2: 1
3: 28
4: 243
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1123019076_1123019084 9 Left 1123019076 14:105389190-105389212 CCTGTCCTCCACCCTTGGCATCT 0: 1
1: 0
2: 5
3: 39
4: 351
Right 1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG 0: 1
1: 0
2: 1
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123019084 Original CRISPR CGGGCTGTGACCAGACTTCC AGG Intronic
900266835 1:1761633-1761655 CGGGCTGTGACCCGGTCTCCAGG + Intronic
900342702 1:2196241-2196263 GAGGCTGGGACCAGTCTTCCTGG - Intronic
900623417 1:3597490-3597512 CCGGCTGTGACCTTACTTCTTGG + Intronic
901922707 1:12548179-12548201 GGGCCTGTGACCAGACCGCCAGG + Intergenic
902569177 1:17335962-17335984 CGAACTGTAGCCAGACTTCCTGG + Intronic
903206495 1:21786201-21786223 AGGGGTGTGACCAGACTTGAAGG - Intergenic
904833425 1:33320184-33320206 CGGGGTTTGACCAGGCTTCTAGG - Intronic
907555288 1:55338094-55338116 GGGAGTGTGACAAGACTTCCTGG + Intergenic
907918372 1:58891210-58891232 CGGGCTCAGATCAGCCTTCCTGG + Intergenic
911286127 1:95995446-95995468 CGCACTGTGACCTGACTTACGGG + Intergenic
915347641 1:155206060-155206082 CAGGCTGTGCCCAGACATCAGGG - Intronic
916844217 1:168631842-168631864 CTGCCTGTGATCAGCCTTCCAGG - Intergenic
918236828 1:182589212-182589234 CGGGCTGCAAGCAGTCTTCCAGG - Exonic
923196557 1:231673990-231674012 AGGACTGAGGCCAGACTTCCTGG + Intronic
924569254 1:245223127-245223149 CAGGCTGTGACCAGCGTCCCTGG - Intronic
924622522 1:245674186-245674208 CGGTCTGTGACCAGCTTTACTGG - Intronic
1064582602 10:16809462-16809484 CGAGCTGTGTCCAGCCTCCCAGG + Intronic
1065241232 10:23707380-23707402 GGGCCTATCACCAGACTTCCAGG - Intronic
1074967130 10:118501232-118501254 AGGGCTGTGACCACACTTCCAGG - Intergenic
1074967134 10:118501255-118501277 GTGGCTGTGACTACACTTCCAGG - Intergenic
1075463276 10:122632609-122632631 GGGGCAGGGGCCAGACTTCCAGG + Intronic
1076849126 10:133084373-133084395 TGGGCTGTGTTCAGACTGCCCGG + Intronic
1077522430 11:3044253-3044275 CTGGCTGTGGCCAGGCTTCTTGG - Intronic
1078680186 11:13468518-13468540 CAGGCTGTTATCAAACTTCCTGG + Intergenic
1082778953 11:57271280-57271302 CAGGCTGGAATCAGACTTCCTGG - Intergenic
1082834823 11:57644035-57644057 GCAGCTGTGACCTGACTTCCTGG - Intergenic
1083773343 11:64880299-64880321 CGGGCCTAGTCCAGACTTCCCGG + Intronic
1088994187 11:114982213-114982235 CAGGCTGAGACCAGACTCCAAGG - Intergenic
1089360643 11:117884016-117884038 GGTGGTGGGACCAGACTTCCCGG + Intergenic
1095292481 12:40491392-40491414 GGGGCTGTAACCTTACTTCCTGG - Intronic
1096259083 12:50079888-50079910 CTGGCTGAGTGCAGACTTCCTGG + Exonic
1098243028 12:68487737-68487759 AGGACAGTGACCAGACATCCAGG - Intergenic
1098879558 12:75903079-75903101 AGGTCTGTGGACAGACTTCCTGG - Intergenic
1103612627 12:122133445-122133467 AGGGCTGTGAACACACCTCCCGG + Exonic
1106790791 13:33153343-33153365 CGAGCTGTGCACAGACTGCCTGG + Intronic
1108062382 13:46546254-46546276 GCGGCTGTGACCAGACATGCAGG + Intergenic
1112109669 13:96282274-96282296 CTGACTTTGACCAGACTTCCTGG - Intronic
1112183850 13:97110038-97110060 CGCGCTGTGACCAGACACGCGGG + Intergenic
1119582968 14:75804085-75804107 CGGGATGTGGCCAGGCCTCCTGG + Intronic
1119667985 14:76498600-76498622 CTGGCTGTGTGCAGACTCCCGGG + Intronic
1120887059 14:89459998-89460020 CCAGCAGGGACCAGACTTCCAGG - Intronic
1122982672 14:105198674-105198696 GGGGCTGTGACCAGAGCTCTAGG + Intergenic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1124700343 15:31907067-31907089 CGGCCTGTGACCTGGCTTCTGGG + Intergenic
1128247151 15:66140831-66140853 CCGGCTGAGCTCAGACTTCCAGG - Intronic
1128555171 15:68626817-68626839 CAGCCTCTGACCAGACCTCCTGG - Intronic
1128639853 15:69328410-69328432 ATGGCTGAGACCAGACTTCAGGG - Intronic
1130086120 15:80779537-80779559 CGGTCAGCGACCAGACGTCCGGG + Exonic
1133417535 16:5618124-5618146 CGGGCAGTGGGAAGACTTCCAGG - Intergenic
1133438763 16:5802955-5802977 GGGGCTGTGTCCATACATCCTGG - Intergenic
1136346678 16:29680315-29680337 TGGAATGTGACCAGACATCCTGG - Intronic
1138261567 16:55627183-55627205 TGGCCTGTGACTAGAATTCCTGG - Intergenic
1140903998 16:79395111-79395133 TGGGCTGTGATCACACCTCCAGG - Intergenic
1141646679 16:85371336-85371358 GGGACAGTGCCCAGACTTCCAGG + Intergenic
1141648853 16:85381912-85381934 CGGGCTGGGGCCAGGCTTCCAGG + Intergenic
1143003499 17:3811164-3811186 TGGGCTGTTACCAGAATTCCTGG - Intergenic
1144444621 17:15315402-15315424 TGGGCTGAGAACAGACTGCCGGG + Intronic
1144727588 17:17509622-17509644 CGGGCTGTGGCGAGACCTGCAGG + Intronic
1146301240 17:31691477-31691499 TGGGCTGTGGGCAGCCTTCCTGG - Intergenic
1148736835 17:49869727-49869749 CAGGCTGTGCACAGACTCCCAGG + Intergenic
1152024626 17:77800872-77800894 CGGGCTGTTCGCAAACTTCCAGG + Intergenic
1154999726 18:21674643-21674665 CTGGCTGAGACCAGCCTTCCTGG + Intronic
1157280916 18:46345797-46345819 CAGGCTGTGCCCCGACTCCCGGG + Intronic
1158697544 18:59716265-59716287 CAGGCTGTGTGCAGAATTCCAGG + Intergenic
1162008053 19:7792492-7792514 TGGAATGTGACCAGACATCCTGG - Intergenic
1163697960 19:18773508-18773530 TGGGGTGGGACCAGGCTTCCAGG - Intronic
1167476642 19:49705178-49705200 TGGGCTGTGAGCTGCCTTCCAGG - Intronic
1168181192 19:54663989-54664011 TGGGCTGTGACCAGCCTACAGGG - Exonic
925072306 2:979458-979480 CGGGCTGTGCCCAGCCTTGCTGG + Intronic
927204005 2:20595549-20595571 CGGGCTGTGGCCAGAATCACTGG - Intronic
929583836 2:43101358-43101380 CGGGCTGTGGCACGACTCCCGGG + Intergenic
930716178 2:54596068-54596090 AGGGCAGTGAGCCGACTTCCAGG - Intronic
931704762 2:64938117-64938139 CGGGCTCTGACCAGAGTGCCAGG + Intergenic
934138427 2:89020206-89020228 GGGGCTGTGACTAGACCTGCAGG + Intergenic
934149778 2:89135194-89135216 GGGGCTCTGACCAGACCTGCAGG + Intergenic
934217519 2:90046837-90046859 GGGGCTCTGACCAGACCTGCAGG - Intergenic
934230828 2:90180419-90180441 GGGGCTGTGACTAGACCTGCAGG - Intergenic
937440068 2:121907938-121907960 CTGGCTGGGACCAGCCTTCCTGG + Intergenic
947739742 2:232479676-232479698 CCGCCTGTGTCCAGCCTTCCTGG - Intergenic
948878697 2:240844381-240844403 CGAGCGGTGACCCGACTCCCTGG + Intergenic
1170467706 20:16638037-16638059 CAGGCTGTGACATGGCTTCCCGG + Intergenic
1170467737 20:16638161-16638183 CGGGCTCTGGACAGAGTTCCCGG - Intergenic
1172224678 20:33297439-33297461 CGGGCTGTGCCCAGCCCACCTGG - Intronic
1173210073 20:41025530-41025552 CAGCCTGTGACAAGACTGCCCGG + Intergenic
1173973572 20:47170923-47170945 CGGGCTTTGAAAAGACTTGCAGG - Intronic
1174180525 20:48671687-48671709 CGGGCTGTAACCACACTCCGAGG + Intronic
1175219906 20:57410718-57410740 CGGGGTGTGCCCAGACATGCAGG + Intergenic
1175231735 20:57477770-57477792 CGAGCTGTGAACAGGCATCCAGG - Intergenic
1175545795 20:59776908-59776930 CTGGCTGTGACCAGGCCACCTGG - Intronic
1176376788 21:6090709-6090731 GGTGCCGTGAGCAGACTTCCCGG - Intergenic
1176410354 21:6446366-6446388 CAGGCTGGTCCCAGACTTCCGGG - Intergenic
1179685847 21:43054688-43054710 CAGGCTGGTCCCAGACTTCCGGG - Intronic
1179746687 21:43447535-43447557 GGTGCCGTGAGCAGACTTCCCGG + Intergenic
1182120320 22:27782179-27782201 CAGGCTGTGACCAGACCACAGGG + Intronic
1182447330 22:30397359-30397381 CGGGGGGTGGCCAAACTTCCTGG - Intronic
1183173470 22:36204877-36204899 CAGCCTGAGACCAGACCTCCAGG + Intergenic
1184313295 22:43662836-43662858 CTGGATGTGAACAGGCTTCCAGG - Intronic
953903090 3:46854232-46854254 CGGGCTCTGGCCAGCCTTCCTGG - Intergenic
954277498 3:49552214-49552236 CTGGCTGTTAGCAGACCTCCAGG - Intergenic
961488928 3:127237625-127237647 CGGGCTGTGACCAGTTCTGCTGG - Intergenic
961638636 3:128350536-128350558 TGGGCTGGGACCAGAATACCAGG - Intronic
961809042 3:129510924-129510946 AGGCCTGTGAAGAGACTTCCTGG + Intronic
969040149 4:4289776-4289798 CGGGCGGTGACCAATCGTCCTGG + Intronic
982544599 4:156718470-156718492 AGGTCTGGGGCCAGACTTCCTGG - Intergenic
983518163 4:168678659-168678681 CGGGCTGTGATGGGACTTCCCGG - Intronic
988193146 5:27964701-27964723 CGGAATGTGTCCAGACTTGCTGG + Intergenic
992840700 5:80689070-80689092 CATCCTGTGACCACACTTCCTGG - Intronic
995524383 5:113038953-113038975 GGGGCTGTGCCCAGCCCTCCAGG - Intronic
999935552 5:156481988-156482010 GGGACTGGGACCAGACTGCCTGG - Intronic
1000335254 5:160237310-160237332 TGGGCAGTGACCAGAGTTCAGGG + Intronic
1002339589 5:178506208-178506230 CAGGCTGAGACCTGACTGCCAGG - Intronic
1003140619 6:3468492-3468514 GCTGCTGTGATCAGACTTCCTGG + Intergenic
1003152363 6:3563649-3563671 TGGGCTGTGAGCAGAGATCCAGG + Intergenic
1007320763 6:41027648-41027670 CGGGGTAGGACCAGGCTTCCCGG - Exonic
1017840927 6:158222367-158222389 GGGGATGTGGCCAGGCTTCCTGG + Intergenic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1021622417 7:22562023-22562045 TGGACTGTGACCAGCCCTCCAGG + Intronic
1024183893 7:46928168-46928190 TGGGCTGTTACAAGGCTTCCAGG - Intergenic
1031918842 7:127587067-127587089 CGGGGTCTGAACAGACCTCCAGG - Intronic
1033314566 7:140286930-140286952 CAGGCTGGGACCAGACTGCCTGG + Intergenic
1034083186 7:148299432-148299454 CTGGCTCTGCCCAGCCTTCCTGG - Intronic
1040124420 8:43720820-43720842 TGGAATGTGACCAGACATCCTGG - Intergenic
1041252511 8:55947916-55947938 CGGTCTGTGAGCACACTTCAGGG + Intronic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1049672877 8:143877567-143877589 CTGTCTGTCACCAGACTGCCCGG + Intronic
1050547642 9:6722206-6722228 AGGGCTGTGATAAGACTCCCTGG + Intronic
1052333018 9:27289937-27289959 AATGCTGTGACCAGACTTGCAGG - Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1186097491 X:6117694-6117716 GGGGCTGTGAATAGACTTTCAGG - Intronic
1187722489 X:22165692-22165714 AGGGCTCTGACCAGATTCCCTGG - Intronic
1191867587 X:65717646-65717668 CCGTCTGTGGCCAGACTTCTAGG + Intronic