ID: 1123019845

View in Genome Browser
Species Human (GRCh38)
Location 14:105392530-105392552
Sequence GTCACCTCCTGGCCTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 398}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123019841_1123019845 9 Left 1123019841 14:105392498-105392520 CCTCTGCTGGCAAGTTGGCACAG 0: 1
1: 0
2: 0
3: 16
4: 143
Right 1123019845 14:105392530-105392552 GTCACCTCCTGGCCTGTCACAGG 0: 1
1: 0
2: 1
3: 23
4: 398
1123019837_1123019845 17 Left 1123019837 14:105392490-105392512 CCGGCCCTCCTCTGCTGGCAAGT 0: 1
1: 0
2: 2
3: 13
4: 315
Right 1123019845 14:105392530-105392552 GTCACCTCCTGGCCTGTCACAGG 0: 1
1: 0
2: 1
3: 23
4: 398
1123019836_1123019845 18 Left 1123019836 14:105392489-105392511 CCCGGCCCTCCTCTGCTGGCAAG 0: 1
1: 0
2: 4
3: 35
4: 335
Right 1123019845 14:105392530-105392552 GTCACCTCCTGGCCTGTCACAGG 0: 1
1: 0
2: 1
3: 23
4: 398
1123019834_1123019845 25 Left 1123019834 14:105392482-105392504 CCAAGCACCCGGCCCTCCTCTGC 0: 1
1: 0
2: 4
3: 48
4: 450
Right 1123019845 14:105392530-105392552 GTCACCTCCTGGCCTGTCACAGG 0: 1
1: 0
2: 1
3: 23
4: 398
1123019839_1123019845 13 Left 1123019839 14:105392494-105392516 CCCTCCTCTGCTGGCAAGTTGGC 0: 1
1: 0
2: 0
3: 12
4: 192
Right 1123019845 14:105392530-105392552 GTCACCTCCTGGCCTGTCACAGG 0: 1
1: 0
2: 1
3: 23
4: 398
1123019840_1123019845 12 Left 1123019840 14:105392495-105392517 CCTCCTCTGCTGGCAAGTTGGCA 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1123019845 14:105392530-105392552 GTCACCTCCTGGCCTGTCACAGG 0: 1
1: 0
2: 1
3: 23
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123019845 Original CRISPR GTCACCTCCTGGCCTGTCAC AGG Intronic
900184198 1:1325265-1325287 GACACCTCCAGGCCTTTCCCAGG - Intronic
901735356 1:11308921-11308943 GTTAATTCCTGGTCTGTCACTGG + Intergenic
901788310 1:11639214-11639236 GTAGCTTCCTGGGCTGTCACTGG - Intergenic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
902508529 1:16953258-16953280 GCCCCCTCCTGGTGTGTCACAGG + Intronic
903049860 1:20592647-20592669 CACACTTCCTGGCCTATCACTGG + Intronic
903326472 1:22571673-22571695 CTCACCTGCTAGCCTGGCACAGG - Intronic
903982234 1:27197479-27197501 GTCTCCTCCTGCCCTGTGTCTGG - Intergenic
904812675 1:33173577-33173599 CTCACCTCCATGCCTGTCCCTGG + Intronic
905289882 1:36913959-36913981 CTCAGCTCCTGACTTGTCACCGG + Intronic
905891698 1:41522122-41522144 GCCACCTCCAGGCCTGCCCCAGG - Intronic
905950156 1:41944104-41944126 CTCACCTCCTGCCCAGTCCCTGG - Intronic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
906292410 1:44627864-44627886 GACACAGCCTGGCCTGGCACAGG + Intronic
906709044 1:47915770-47915792 GCCACCTCATGCCCTGTGACAGG - Intronic
906884318 1:49628104-49628126 AACAGCTCCTGGCATGTCACTGG - Intronic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
907833165 1:58084658-58084680 GGGACCTGCTGGCCAGTCACTGG - Intronic
907892265 1:58647403-58647425 ATCACCCCCTGGCCTGTTTCTGG + Intergenic
908225618 1:62053117-62053139 GACACCTGCAGCCCTGTCACTGG - Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912387256 1:109277697-109277719 GTCACCTTCTGGCCTCACCCAGG + Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
914033132 1:143976108-143976130 GTCCCTTCCTGGTCAGTCACTGG + Intergenic
914225972 1:145719865-145719887 GGCACCTCCCGGCTTGTCTCAGG - Intronic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
916674488 1:167054318-167054340 CTCTGCTGCTGGCCTGTCACTGG + Exonic
917342668 1:173995643-173995665 GTCACCTCCTGCCCCTTCAGTGG - Intronic
917443078 1:175083860-175083882 GCTACCTCCTGTCCTGTCATGGG - Exonic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
917927376 1:179800543-179800565 GTCACCCCCAGGCCTTCCACAGG + Intronic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
920376773 1:205512958-205512980 CTCTCCTGCTGGCCTGTCATGGG - Intronic
920468617 1:206206993-206207015 GTCCCTTCCTGGTCAGTCACTGG + Intronic
922474735 1:225899166-225899188 GTCACATCCTGGCCTATCAGGGG + Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1062769303 10:86694-86716 GTCAGCTCCTTGCCTGTGAACGG - Intergenic
1062815983 10:500234-500256 GCCAACCCCTGGCCTGTCTCAGG + Intronic
1062908821 10:1199235-1199257 GGCGACTCCTGGCCTTTCACAGG - Intronic
1063136948 10:3225707-3225729 GTACACTCCTGGCCTGTCTCTGG + Intergenic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1068007671 10:51409534-51409556 GACAGCTCTTGGCCTGTCACTGG - Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069882732 10:71603654-71603676 CTCACCTCCTGGCCAGACTCCGG + Intronic
1071562464 10:86654980-86655002 GTCCCCTCCTGGCCACACACAGG + Intronic
1072009480 10:91290885-91290907 TGCACTTCCTGCCCTGTCACCGG + Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1074269606 10:111940869-111940891 GTAACCTGCTGGCTTGTCATTGG - Intergenic
1074411373 10:113231413-113231435 GTACCCACCTGGCTTGTCACTGG + Intergenic
1074615110 10:115059762-115059784 GTCTCCTCCTGCCCTTCCACAGG - Intergenic
1075371781 10:121943007-121943029 GTCATCTCCTGGCTGGTCTCAGG + Intergenic
1075772294 10:124949780-124949802 GCCACCACCTGGCCTGAAACTGG + Intronic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1077560658 11:3258284-3258306 GGCACCACCTTGCCTGGCACAGG - Intergenic
1077566554 11:3304112-3304134 GGCACCACCTTGCCTGGCACAGG - Intergenic
1078452412 11:11450020-11450042 TTCACCTGATGGCCTGTCCCAGG - Intronic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1080722364 11:34862443-34862465 GTCACTGGCTGGCCTGTGACAGG - Intronic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081760651 11:45574536-45574558 ATCACCTCCTGCACTGTCCCTGG + Intergenic
1081990266 11:47333688-47333710 CTCACCTCCTCGCCTGCCAGGGG + Exonic
1083624247 11:64063942-64063964 GTCACCTCTTAGTCTATCACTGG - Intronic
1083921118 11:65781684-65781706 GTCAGGGCCTGGCCGGTCACGGG + Intergenic
1084517427 11:69644392-69644414 GCCCCCTCCTGGCCTCTCCCAGG + Intronic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087434195 11:98091999-98092021 GACACCTCCTAAGCTGTCACTGG + Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1088836657 11:113583399-113583421 GACAGCTCTTGGCCTGTCACTGG + Intergenic
1089209860 11:116792511-116792533 CTCACCTCCTGCCCTTTCCCTGG + Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1089920254 11:122203034-122203056 TTCTCCTCCTGTCCTGTAACTGG - Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090880792 11:130830180-130830202 GTCACCTTCAGGCCTTTCCCTGG - Intergenic
1090908279 11:131096326-131096348 GACACCTCATGGCCTGTGGCGGG - Intergenic
1091400982 12:180553-180575 TTCCTCTCCTGGCCTGTGACTGG - Intergenic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1092257510 12:6935705-6935727 CTCATCTTCTGGCCTGTCCCAGG + Exonic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1094398031 12:30029732-30029754 CTCACCTCCTGCCCTCTCCCAGG + Intergenic
1095121505 12:38424833-38424855 GGCAACTCTTGGCCTGTGACAGG - Intergenic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1098186051 12:67897343-67897365 GCCACTGCCTGGCCTGTTACTGG - Intergenic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1103279958 12:119749196-119749218 GTCATCTCCTAGCCTGTGAAAGG - Intronic
1105592000 13:21800808-21800830 GTCACTCTCTGGCCTTTCACAGG - Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1106480507 13:30133747-30133769 ACCACCTCCTGGGCTGGCACTGG - Intergenic
1108601496 13:51998963-51998985 CTGCCCTCCTGTCCTGTCACAGG - Intronic
1108681481 13:52784519-52784541 GTTTCCTGCTGGCCTGTCAGAGG + Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1113853513 13:113431308-113431330 GTCTCCGCATGGCGTGTCACGGG - Intronic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1115130694 14:30049271-30049293 GACAGCTCTTGGCCTGTCACTGG + Intronic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1118008522 14:61586964-61586986 GACTCCTCCTGGCCTATCCCTGG + Intronic
1118050507 14:62021326-62021348 GTTACCTCCTTGGCTGTCATGGG + Intronic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119474029 14:74916960-74916982 GTCACCTCCCGGCCAGTCCCTGG + Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120749683 14:88186240-88186262 GTCACCTCCTGGCCTCCCCGTGG - Intronic
1121015854 14:90548645-90548667 TGCACCTCCAGGCCTGACACTGG + Intronic
1122247904 14:100417234-100417256 GTCAGCACCAGGCCTGGCACAGG - Intronic
1122863490 14:104593204-104593226 GGCACCTCCAGGCCTCGCACAGG - Exonic
1123017671 14:105383127-105383149 GTGGCCTCCTGGCCTGTCCTTGG + Intronic
1123019845 14:105392530-105392552 GTCACCTCCTGGCCTGTCACAGG + Intronic
1123023518 14:105412953-105412975 GCCACCTGCTGCCCTGACACAGG + Exonic
1127388936 15:58489768-58489790 CTGACCTTCTGGCCTTTCACTGG + Intronic
1128133285 15:65245040-65245062 GTCACCTCCTGGCCAGGGAATGG - Intronic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1132383880 15:101386296-101386318 GGCACCTGCTGGGATGTCACAGG + Intronic
1133035904 16:3034145-3034167 GTCCACTCCTTGCCTGGCACTGG - Intronic
1133203562 16:4219316-4219338 CTCACATCCTGCCCTGTCCCTGG + Intronic
1134891580 16:17845960-17845982 CTCACCTCATGCACTGTCACAGG + Intergenic
1136279760 16:29201460-29201482 GCCACCTCCTGCCCTGGCCCTGG + Intergenic
1139393774 16:66623335-66623357 GTGACCTGCTCGCCTGTCCCTGG - Intronic
1139745893 16:69074043-69074065 GTTACCTCCTGGGCTTTCTCAGG - Intronic
1140525931 16:75622952-75622974 GGCACCTCCTATCCTGTAACTGG - Intronic
1140541953 16:75764232-75764254 GTAACCTGCTGGCCTCTCACAGG - Intergenic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1142084149 16:88167570-88167592 GCCACCTCCTGCCCTGGCCCTGG + Intergenic
1145081475 17:19897941-19897963 GTCTCAGCCTGGACTGTCACGGG + Intergenic
1145282833 17:21480274-21480296 GCCACCTCCTGGCCTTTCCCTGG + Intergenic
1145394642 17:22485523-22485545 GCCACCTCCTGGCCTTTCCCTGG - Intergenic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1147133556 17:38422555-38422577 GCCACCTCCTGACCTGACATGGG + Intergenic
1147597739 17:41727602-41727624 GTCACCTGCTGGGCTGTGCCAGG + Intronic
1148103321 17:45105823-45105845 GTCACCTCCGGTCGTGTCTCTGG + Exonic
1148108818 17:45133021-45133043 GGCAGCACCTGGCCTGGCACAGG - Intronic
1148117138 17:45182710-45182732 CTGACCTCCTGCCCTTTCACAGG - Intergenic
1148691201 17:49528048-49528070 TTCTCCCCCTGGCCTCTCACTGG - Intergenic
1148794598 17:50190952-50190974 GTCACCTCCTTGCCCCACACTGG - Intronic
1149700857 17:58654257-58654279 GACACCACCTGGCCTTTCTCAGG + Intronic
1151596086 17:75078739-75078761 GTCTCCACCTGGCCTGTTCCGGG + Intergenic
1152430318 17:80245222-80245244 GTCTCCTCCTACCCGGTCACAGG + Exonic
1152613329 17:81326442-81326464 GGCCCCTCCTGGCCTTGCACAGG + Intronic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1153536665 18:6109434-6109456 GTCACCCACAGGGCTGTCACTGG - Intronic
1154400789 18:14034823-14034845 GTCATCTGCTGGCCTCTCCCAGG + Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1157278887 18:46333090-46333112 GTCCCCAGCTGGACTGTCACAGG + Intronic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159106198 18:64003708-64003730 GTCTCCTCCTGCCCTCTGACTGG - Intronic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160158496 18:76451979-76452001 GCCGCCTCCAGGCCTGTCATCGG - Intronic
1160423619 18:78766048-78766070 TTGACCTCCTGGCTTGTCAGGGG - Intergenic
1160728632 19:630237-630259 TGCACCTCCTGGCCTGGCTCAGG - Intronic
1160936132 19:1595997-1596019 GTCACCTCCTGGGCTGGCGAGGG + Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1164581533 19:29438374-29438396 GCCACCTCTGGGCCAGTCACAGG + Intergenic
1166074896 19:40408260-40408282 TTCACATCCTGGCCTTTCCCTGG - Intronic
1166128847 19:40733375-40733397 GGAACCGCCTGGCCTGTCCCGGG + Intronic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926942535 2:18153632-18153654 GTCACCTCAGGCCCTGTGACAGG + Intronic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927466447 2:23340358-23340380 GTCTCTTCCTGGCCTGCCTCAGG - Intergenic
932870706 2:75395074-75395096 GACAGCTCCTGGCCTGTTACTGG - Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
933725051 2:85421938-85421960 GTCACCTCCTGGGCTCTCTTGGG + Intronic
934772915 2:96919449-96919471 GTCACCTCCTTTCATCTCACCGG - Intronic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
938370784 2:130767180-130767202 TGCACCTGCTGGCCTGACACTGG - Exonic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
940605915 2:155924279-155924301 GACAGCTCATGGCCTGTTACTGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
944948702 2:204721348-204721370 GTCACCTCCTAGACTCTTACAGG - Intronic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
948810750 2:240476507-240476529 GTCACCGCAGGGCCTTTCACAGG + Intergenic
1174756378 20:53162582-53162604 GTCACGTCCTGGGCTGACACTGG - Intronic
1175367948 20:58468102-58468124 GTCTCATCCTTGCCTGTGACAGG + Intronic
1176024405 20:62978472-62978494 GACACCACCTCGCCTGTCCCAGG + Intergenic
1176250893 20:64119340-64119362 GCCTCCTCCTGGTCTGTCTCTGG + Intergenic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1179176888 21:39014347-39014369 GTCACGACCTGGCTTGTCCCTGG - Intergenic
1179278272 21:39911406-39911428 CTCACCTCGAGGCCAGTCACTGG - Intronic
1179825451 21:43963154-43963176 TTCACCTCCTTTACTGTCACTGG - Intronic
1179913927 21:44464412-44464434 GTCCCCTCCTGCCCTGGCCCTGG + Intergenic
1180119403 21:45736852-45736874 GTCACCCCCTGACATGCCACAGG - Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1180840295 22:18955958-18955980 GTCCCCTCCAGGCCCGTCACTGG + Intergenic
1181061192 22:20282818-20282840 GTCCCCTCCAGTCCTGTCCCTGG - Intronic
1181409897 22:22711523-22711545 TTCACCTCCTGATCTGTCCCTGG + Intergenic
1181769972 22:25118311-25118333 GTCATCTCCTTTCCTGTCTCTGG + Intronic
1182024455 22:27107055-27107077 GCCAACTCCTTGCCTGTCAAGGG - Intergenic
1182401487 22:30080939-30080961 CTCACCTCTTGGCCTGTACCAGG - Intronic
1183689380 22:39379778-39379800 CTCACCTCCTTCCCTTTCACTGG - Intronic
1184245077 22:43231677-43231699 TTCCCCTCCTGGGCTGACACGGG - Intronic
1184324748 22:43774672-43774694 GTCACCTTCCATCCTGTCACCGG - Intronic
1184459891 22:44631115-44631137 GTCACCTCATGGCCAGCCCCTGG + Intergenic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
1184884685 22:47335597-47335619 CTCAGTTCCTGGCCTGTCTCAGG + Intergenic
1184947903 22:47817303-47817325 AACACCTCCTGCCCTGACACAGG + Intergenic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
950156312 3:10724016-10724038 TTAACCTCCTGGCCTGACATAGG - Intergenic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954214276 3:49115842-49115864 GCCTCCTCCTGGCCTGTCAGGGG + Exonic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
954716281 3:52528507-52528529 ATCACCTCCTCGTCTGGCACAGG + Exonic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
957879155 3:86187758-86187780 CACACATCCTGGCCTGTCAGGGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
958592523 3:96175750-96175772 TTCAGCTCCAGGCCTGCCACAGG - Intergenic
962576882 3:136763202-136763224 GACACCTCCAGGCCTGTGATGGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG + Intergenic
964679244 3:159318906-159318928 GACAGCTCATGGCCTGTTACTGG - Intronic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968588700 4:1446888-1446910 TTCACACCCTGGCCTGGCACAGG - Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
969524573 4:7697681-7697703 GCCCCCTCCTGGCCTCTCTCTGG - Intronic
969595165 4:8144609-8144631 GTCACCCGCTGGGCTGGCACTGG - Intronic
969662802 4:8540177-8540199 GTAACTTCCTGCCCTGTCTCTGG + Intergenic
970333415 4:15005134-15005156 GCCGCCTCCTTGGCTGTCACAGG + Intronic
971385894 4:26140253-26140275 GCCACAGCCTGGGCTGTCACTGG - Intergenic
971394499 4:26215818-26215840 CTCACCTCCTTGCCAGTCTCTGG + Intronic
972145935 4:36025449-36025471 ATCACCTCCTGTCTCGTCACTGG + Intronic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
973864292 4:55096224-55096246 CTCACCTCCTGGCTTGGTACAGG + Exonic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG + Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
981614627 4:146633953-146633975 GTCAACTACTATCCTGTCACTGG - Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
984448365 4:179867507-179867529 GTAACCTCCTGGCCTGCAACTGG + Intergenic
985396891 4:189553621-189553643 GTCTCCTCCTGGACTGCCAAAGG + Intergenic
985747907 5:1657574-1657596 GTCCCTTCCTGGCCTCTCCCAGG + Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986670857 5:10141127-10141149 CTCACCTCCTGGGCTGTCCAAGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
986959839 5:13199227-13199249 GTCAGCTCTTTGCCTGTTACTGG + Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG + Intergenic
988915124 5:35884272-35884294 GTCATATCCTGGCCTGTAAGAGG - Intergenic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989574030 5:42972356-42972378 GTCACCTCCTGCTGTGTCGCAGG + Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991503979 5:67305447-67305469 GTCATCTCCTGGACAGACACTGG - Intergenic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995174234 5:109156181-109156203 CTTACCTCCTGGCTTGTCTCTGG - Intronic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
998402672 5:141856043-141856065 GTCCCCTCCTCACCTGGCACTGG - Intronic
999351386 5:150874854-150874876 GACAGCTCTTGGCCTGTCACTGG + Intronic
1001150141 5:169220147-169220169 TTCACCTCCTGCCCTGTCCTTGG + Intronic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003418960 6:5938626-5938648 CTCACCTCCTGACGTGTGACAGG + Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1006434904 6:34020975-34020997 GTCCCCTCCTGCCCTGCCCCTGG - Intronic
1007319593 6:41017904-41017926 GTCACCTCTGTGCCTGGCACAGG - Intergenic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1009806495 6:68606962-68606984 GACAGCTCCCGGCCTGTTACTGG + Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011069102 6:83361675-83361697 GACAGCTCCTGGCCTGTTACTGG + Intronic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1013041516 6:106438549-106438571 GTCTCCTCCTGCATTGTCACAGG + Intergenic
1014398164 6:120952896-120952918 CGCACCTCCTGTCCTGTGACGGG - Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016184118 6:141179339-141179361 GGCACCTTCAGTCCTGTCACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1018016057 6:159713349-159713371 GCCAGCCCCTGGCCTATCACTGG + Intronic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021001749 7:15340458-15340480 GAGGCCTCCTGGCCTGTGACAGG - Intronic
1021322859 7:19232848-19232870 CTCACATCATGGCCTGTCAGGGG + Intergenic
1021574483 7:22094740-22094762 GTCTCCTGCTGGCCAGTCAGTGG - Intergenic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1023940334 7:44765288-44765310 GTTACCTCCTGGCCTGCTGCTGG - Intronic
1024007505 7:45237955-45237977 CTCAGCTCCTGGCCTTTCAGAGG + Intergenic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1026920141 7:74149476-74149498 CTCATCTCCTGACCTGACACGGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1029491453 7:100872667-100872689 GTCTCCTCCTGACCTGGCTCAGG - Exonic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1031194166 7:118591087-118591109 TACACCTCCTGGCCTGTGATAGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032841546 7:135717906-135717928 GTCATCTCCTGCCCTGGGACTGG + Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1034249578 7:149677347-149677369 GTCCTGTCCTGGCTTGTCACAGG + Intergenic
1034306315 7:150047759-150047781 GTCACCTCCTGGGCGGCCAGGGG - Intergenic
1034800532 7:154052894-154052916 GTCACCTCCTGGGCGGCCAGGGG + Intronic
1035574770 8:697496-697518 GGGACCTGCAGGCCTGTCACTGG - Intronic
1036280131 8:7393380-7393402 GCCACCTCCTGGCCTGGGCCTGG - Intergenic
1036341392 8:7918503-7918525 GCCACCTCCTGGCCTGGGCCTGG + Intergenic
1037439006 8:18894991-18895013 GTAACAGCATGGCCTGTCACTGG - Intronic
1037723815 8:21467031-21467053 GTGACCTCGGGGCCTGTCACTGG - Intergenic
1041986182 8:63924481-63924503 GATAGCTCTTGGCCTGTCACTGG + Intergenic
1042044206 8:64629934-64629956 GTCCCCACCAGGCCTCTCACTGG - Intronic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1048590531 8:135816964-135816986 GTCTCCTCCTGCCCTGAAACTGG + Intergenic
1049023184 8:139971354-139971376 CCAACCTCCTGGCCTGGCACAGG + Intronic
1049933951 9:482700-482722 ATCACCTGCTGGCCTATCATTGG + Intronic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1052442269 9:28512274-28512296 GTCAGCTCCTGGCCTGTTACTGG - Intronic
1052819746 9:33129326-33129348 GTCACCCCAAGGACTGTCACAGG + Intronic
1052988422 9:34504238-34504260 ACCACATCCTGGCCTGTCCCTGG + Intronic
1055126054 9:72719154-72719176 GCCACCTCCCTGCCTGTCACCGG + Intronic
1055903940 9:81271196-81271218 GATACCTCTTGGCCTGTTACTGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056984675 9:91351620-91351642 CTCACCTCCTGCTGTGTCACCGG - Intronic
1059362467 9:113755734-113755756 TTTACCTCCTTCCCTGTCACTGG - Intergenic
1059692499 9:116699118-116699140 GCCACTGCGTGGCCTGTCACAGG + Exonic
1059758451 9:117316261-117316283 GTCAGCTCCTGGTCTGTGCCTGG + Intronic
1060152231 9:121296052-121296074 GTCACCTCCTGCCCTGGCCTGGG + Intronic
1060526622 9:124324622-124324644 GCCACCTCCAGGCCTGTGGCGGG - Intronic
1061239240 9:129359570-129359592 ATCACCTCCTGACCTGTGTCTGG + Intergenic
1061681033 9:132242497-132242519 GACACCCCCTGGCCTGTGCCAGG + Exonic
1061791139 9:133059725-133059747 ACCCCCTCCTGCCCTGTCACTGG - Intergenic
1062026685 9:134343887-134343909 CTCACCTTCTGGCCGGTCATTGG + Intronic
1062709887 9:137969356-137969378 CACACATCCTCGCCTGTCACAGG - Intronic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1189134143 X:38531878-38531900 GTGAGCTCCTGGGCTCTCACTGG + Intronic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191258770 X:58291444-58291466 GACACCCCCAGGCCTGGCACAGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191719241 X:64215702-64215724 GACAGCTCCTCGCCTGTTACTGG - Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1195003968 X:100668822-100668844 GTCACCACCTGGCTTGTGAGGGG + Intronic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199743770 X:150759066-150759088 GTGACCTGCTGCCCTGTCACTGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic