ID: 1123019958

View in Genome Browser
Species Human (GRCh38)
Location 14:105393028-105393050
Sequence CTGGCCTCCGCCTGAGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123019958_1123019967 20 Left 1123019958 14:105393028-105393050 CCAGAGCCTCAGGCGGAGGCCAG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 1123019967 14:105393071-105393093 CTGTCCTCAGTCACCGTGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 179
1123019958_1123019969 24 Left 1123019958 14:105393028-105393050 CCAGAGCCTCAGGCGGAGGCCAG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 1123019969 14:105393075-105393097 CCTCAGTCACCGTGGAAGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 159
1123019958_1123019964 -10 Left 1123019958 14:105393028-105393050 CCAGAGCCTCAGGCGGAGGCCAG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 1123019964 14:105393041-105393063 CGGAGGCCAGCTGGGTGGGCAGG 0: 1
1: 0
2: 0
3: 41
4: 441
1123019958_1123019966 16 Left 1123019958 14:105393028-105393050 CCAGAGCCTCAGGCGGAGGCCAG 0: 1
1: 0
2: 0
3: 29
4: 277
Right 1123019966 14:105393067-105393089 GCAGCTGTCCTCAGTCACCGTGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123019958 Original CRISPR CTGGCCTCCGCCTGAGGCTC TGG (reversed) Intronic
900369937 1:2327784-2327806 CTGGTCACCGCCAGAGGCACAGG - Intronic
900963713 1:5942873-5942895 CGGGCATCCTCCTGAGCCTCTGG - Intronic
901055356 1:6446595-6446617 CAGGCCCCTGGCTGAGGCTCTGG + Intronic
901692053 1:10980169-10980191 CTGGGCTGGGCCTGAGGCCCTGG - Intronic
903181750 1:21608418-21608440 CTGGCCACCTTCTGAGGCACGGG + Intronic
904615005 1:31744812-31744834 TTGCCCTCCGCCTGAGGGCCTGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905290752 1:36920419-36920441 CTGCTCTCTGCCTGAGGCCCAGG + Intronic
907870441 1:58438078-58438100 CTGTCCTCTCCCTGAGGCCCCGG + Intronic
912418975 1:109530779-109530801 CTGGCCTGCACGTGAAGCTCAGG + Intergenic
912964934 1:114229162-114229184 CTGGCCTCTGCCTGCACCTCTGG - Intergenic
914446504 1:147755151-147755173 CTGGCCTCTGTCTGAGGATAAGG - Intergenic
915234769 1:154472588-154472610 CTGGCCTCCTTCTGATGCACAGG - Intronic
916079369 1:161222918-161222940 TTGGCCTCGGCCTGAAGCTCTGG + Exonic
917240356 1:172941404-172941426 GTGGCCTCAGCCTCATGCTCAGG + Intergenic
919804759 1:201375026-201375048 CTGTCCTCATCCTGAGGCTTGGG - Intronic
920595701 1:207267783-207267805 CTGGTTTCAGCCTGTGGCTCGGG - Intergenic
920657532 1:207887835-207887857 CTGGCCTTTCCCTGAGCCTCAGG + Exonic
920664903 1:207956130-207956152 CTGGCCTCTGCCAGGGCCTCAGG + Intergenic
921213607 1:212919824-212919846 CTGGCACCTGCCTGAGGCTGAGG - Intergenic
922726916 1:227926946-227926968 GTGGCCTGCGCCTGTGGCCCTGG - Intronic
923045246 1:230350808-230350830 CTGGCCTCCGCAGGAGCATCTGG + Intronic
923545343 1:234919373-234919395 CTGCCCTCCCCCTGAGGCCCAGG + Intergenic
924187887 1:241515398-241515420 CTGACCTCCTCCTTAGTCTCTGG + Intronic
1063155804 10:3378509-3378531 CCGGTCTCCCCCTGAGGCCCTGG + Intergenic
1066215001 10:33277551-33277573 CTGGCAACGCCCTGAGGCTCAGG - Intronic
1067208372 10:44238708-44238730 CTGGCTTATGCCTGAGGCCCTGG - Intergenic
1067241255 10:44496884-44496906 CTCTCCTCCTCCTGAGACTCTGG + Intergenic
1067832132 10:49616395-49616417 CTGGCCTCCTCATGGGGCTGGGG + Intronic
1068862511 10:61861673-61861695 CTGGCCTCAATCTGAGGCTCAGG - Intergenic
1069716270 10:70523304-70523326 CTGGCCTTGGCCTGAAGCTGTGG + Intronic
1069930547 10:71878629-71878651 TTGGCCTCTGCCTGGGCCTCGGG - Intergenic
1071597156 10:86936679-86936701 CTCTCCTCGGCCTGGGGCTCTGG - Exonic
1072099561 10:92216362-92216384 CACACCTCCGCCTGAGCCTCGGG - Intronic
1072555803 10:96513166-96513188 CTGGCCACCGCCAGACGCTCCGG - Intronic
1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG + Intronic
1075512396 10:123083120-123083142 CTGTCCTCCACCTGAAGCTCAGG - Intergenic
1075587129 10:123666240-123666262 CGGGAGGCCGCCTGAGGCTCCGG + Intergenic
1076342575 10:129759814-129759836 CTGCACTCCCCCTGAGGCCCAGG + Intronic
1076610315 10:131722265-131722287 CAGGCCTCAGCCAGGGGCTCAGG + Intergenic
1076688567 10:132209189-132209211 CGGGCCTCCACCTGTGGCTTTGG + Intronic
1076848949 10:133083630-133083652 CAGGCCGACGCCTGAGGCTCAGG - Intronic
1076875178 10:133212437-133212459 CTGGCTTCTGCCTTAGTCTCTGG - Intronic
1077582182 11:3423440-3423462 CTCGGCCCCGCCTGAAGCTCCGG - Intergenic
1079130093 11:17742257-17742279 CTGGCCTCTGCCAGAAGCTTTGG + Intronic
1081047703 11:38296526-38296548 CTGCCCTGGGCCTGCGGCTCTGG + Intergenic
1081595731 11:44458159-44458181 CTGGCCCCTGCCTGGGGCTGGGG - Intergenic
1081677406 11:44979006-44979028 CTGGGCTAGGCCTGAGGCTCAGG - Intergenic
1084115930 11:67042969-67042991 CTGGACCCTGCCTGAGGCTGGGG - Intronic
1084446861 11:69208893-69208915 CACGCCTCTGCCTCAGGCTCTGG + Intergenic
1084946784 11:72642779-72642801 CCGGTCTCTGCCTGGGGCTCTGG - Intronic
1085379270 11:76098373-76098395 CTTACCCCCGCCTGAGCCTCTGG - Intronic
1087618908 11:100520233-100520255 CTTGCCTCTTCCTGAGGATCAGG - Intergenic
1087685233 11:101255215-101255237 CTGGTCTCTGCCACAGGCTCTGG + Intergenic
1090440071 11:126718187-126718209 CTGCCCTCTGCCTCAGGCTCAGG + Intronic
1091718431 12:2795593-2795615 CTGGCCCCGGGCTGCGGCTCGGG - Intronic
1094512357 12:31104134-31104156 CTGGTCTCCGCAGGAGGCTGTGG + Exonic
1095954166 12:47797032-47797054 CGGGCCGCCGCCGGAGGCTGGGG + Exonic
1096121436 12:49091771-49091793 CTGGCCCCCGCCCCAGGCACCGG + Intronic
1097280960 12:57845465-57845487 CGCGCCTCCACCTGACGCTCTGG + Intronic
1097777962 12:63669316-63669338 GTGGCGTCAACCTGAGGCTCTGG - Intergenic
1101446267 12:104738878-104738900 CAGGCCACAGCCTGAGGCGCTGG - Intronic
1101792122 12:107937031-107937053 CTGGGCTCTGCATCAGGCTCAGG - Intergenic
1102659983 12:114517952-114517974 CTGACTTCCGCCTGACTCTCAGG - Intergenic
1103541413 12:121669074-121669096 CTGGCCTGCCCCCGGGGCTCTGG - Intronic
1103601087 12:122055087-122055109 CTGGGCTCTGCCTTGGGCTCTGG + Intronic
1104759211 12:131287047-131287069 CTGGCCTCCACCCCATGCTCAGG + Intergenic
1106072298 13:26424463-26424485 CTGGCGTCCGCCTAGGGCCCCGG + Intergenic
1107126109 13:36848871-36848893 CTGAGCTCTGCCTGGGGCTCTGG - Intronic
1112506987 13:99981389-99981411 CTGGACTCCGCCTGCCGCCCCGG + Intergenic
1113784288 13:112994330-112994352 CTGGCCCCCGCCCGAGACACCGG - Intronic
1114482225 14:23042985-23043007 CTGGCATCCTCCTCTGGCTCCGG - Exonic
1115770526 14:36661286-36661308 GTGGCCCCCACCTGTGGCTCGGG + Intronic
1117135459 14:52730559-52730581 CAGGCCTCTCCCTGTGGCTCCGG + Intronic
1118574794 14:67231542-67231564 CTCGCCTCAGCCTGAGCCACTGG + Intergenic
1118917983 14:70123925-70123947 CTGGCCTCCCTCCCAGGCTCCGG + Intronic
1119384351 14:74248027-74248049 CTGGCCTCTGTCTGTGCCTCAGG - Intronic
1119855386 14:77896549-77896571 CTGGCCTCCGCCTGGGCCTGGGG + Intronic
1120782261 14:88495582-88495604 CTGTCCTCCCCCTGAGCCCCCGG - Intronic
1121020867 14:90579271-90579293 GCGGCCTCTGCGTGAGGCTCTGG - Intronic
1121340915 14:93104621-93104643 CTGGCCTCTCCCTGAGTCTCAGG + Intronic
1121574430 14:94971969-94971991 CTTGGCTCCTTCTGAGGCTCTGG - Intergenic
1121736163 14:96219683-96219705 CTGGCCTACGACAGGGGCTCAGG - Intronic
1122722564 14:103730453-103730475 CTGGCCTTCATCTGAGCCTCAGG - Intronic
1122883066 14:104698804-104698826 CAGGGCTCCGGCTGAGGCCCCGG - Intronic
1123019958 14:105393028-105393050 CTGGCCTCCGCCTGAGGCTCTGG - Intronic
1125477356 15:40056035-40056057 CTGGTCTCCGCCTGAGGTAGAGG - Intergenic
1125500612 15:40238554-40238576 CTGGGCTCCACCTGGCGCTCCGG + Intergenic
1125760679 15:42093805-42093827 CTGGCCACCACCTGGGGCACCGG + Intronic
1126639231 15:50807901-50807923 CTGGCCTCAGCCTGATCCTGTGG + Intergenic
1129326440 15:74802517-74802539 CTGGCCTCCGCCTGGGTCATGGG + Exonic
1129663249 15:77565052-77565074 CTGGCTGCTGCCAGAGGCTCTGG - Intergenic
1131367637 15:91853649-91853671 CTGGCCTCCTCCTCCGGCTCCGG - Intergenic
1132204484 15:99977010-99977032 CTGTCTGCTGCCTGAGGCTCCGG + Intronic
1132712862 16:1277022-1277044 CTGCCCTCCTCCTGTGGCTGAGG - Intergenic
1135003992 16:18801936-18801958 CCGCCCTCCGCCTGAGGCAACGG - Intergenic
1136022634 16:27449730-27449752 CTGGGCTCCGCCTCAGTCACAGG - Exonic
1136548015 16:30966156-30966178 CTGCCCTCCTCCTCAGTCTCGGG + Exonic
1136630933 16:31488864-31488886 ACGGCCTCCGCCGCAGGCTCTGG + Exonic
1137610942 16:49817162-49817184 CTGGGGCACGCCTGAGGCTCTGG + Intronic
1137724940 16:50650775-50650797 CTGGCCCCAGCCTGAGTCTTGGG + Intergenic
1138607114 16:58096600-58096622 CTGGGCTCTGCCTGAGGACCTGG - Intergenic
1139271337 16:65686210-65686232 CTGGCTTCTCCCTGAAGCTCTGG + Intergenic
1139517482 16:67460355-67460377 CTGACCTCCTCCCTAGGCTCAGG + Intronic
1139548309 16:67660080-67660102 CGGGCCTCCGCCTCGGTCTCCGG + Intronic
1139599227 16:67976592-67976614 CAGGCCTCAGCCACAGGCTCTGG - Intronic
1139916233 16:70430117-70430139 CAGGCCTCCACCTGGGCCTCTGG + Intronic
1140044284 16:71430455-71430477 CTGTCCTCCACCTGAGCCTTAGG - Intergenic
1140589095 16:76329963-76329985 CTGTCCTTCGCCAGAGCCTCGGG + Intronic
1140904155 16:79396167-79396189 CAGGCCTCCTCCTGAGACACAGG + Intergenic
1141529814 16:84638359-84638381 CTGGCCTCAGCCTGATCCCCAGG + Intergenic
1142232823 16:88907700-88907722 CTGGCCTCCCTCTGTGGCTTGGG + Intronic
1142468337 17:148308-148330 CTGGCCCCCGGCGGAGGCCCAGG - Intronic
1142756560 17:2019707-2019729 CTGGCCTCCGCCTCAGCTTGCGG - Intronic
1143081070 17:4381774-4381796 CTGCCCTGAGCCTGTGGCTCAGG + Intergenic
1143779253 17:9220892-9220914 CTGGCCTCCGTGAGAGTCTCGGG - Intronic
1144076347 17:11723008-11723030 CAGTCCTCCTCCTGAGTCTCTGG + Intronic
1144366706 17:14551497-14551519 CTGGCCTCTCCCTGAGTGTCTGG - Intergenic
1144520820 17:15951310-15951332 CTGGCCTCAGCCTGGGCCTCTGG - Intronic
1144841350 17:18188324-18188346 CTGGCCTAGGCCTGGGTCTCTGG - Intronic
1144871862 17:18376867-18376889 CTGGGCTCTGGCTGAGGCCCGGG - Intergenic
1144950120 17:18989426-18989448 CTGGGCTCCTCCTGGGCCTCAGG + Intronic
1146626675 17:34440225-34440247 CTGGCCTCGGCACCAGGCTCAGG + Intergenic
1146724692 17:35147764-35147786 CTTGCCTCAGCCAGTGGCTCTGG - Intergenic
1147349969 17:39834895-39834917 GTGGCCTCCTCCACAGGCTCTGG + Intronic
1147757012 17:42775418-42775440 CTGGCCTCCGCCACATGATCAGG - Exonic
1148153120 17:45408100-45408122 TTGGCATCTGCCTAAGGCTCAGG - Intronic
1148484738 17:47983318-47983340 CTTGCCTCAGCCTGGGGATCAGG - Intergenic
1149308380 17:55371143-55371165 CTGGCCTCTACCTGATGCTCAGG - Intergenic
1151224022 17:72635154-72635176 TCGGCCTCCTTCTGAGGCTCAGG - Intergenic
1151749429 17:76028199-76028221 CTGGGCTCTGGCTGAGGCCCGGG + Intergenic
1152175205 17:78782448-78782470 CCGGCCTCCTCCCGAGGCTCCGG + Intergenic
1152414144 17:80147839-80147861 GTAGCCTCCGCCTCAGCCTCTGG + Intergenic
1155474727 18:26226629-26226651 CAGCCCTGCGCCTCAGGCTCGGG - Exonic
1157599671 18:48886197-48886219 CTGAGCTCCCTCTGAGGCTCTGG - Intergenic
1158132400 18:54167218-54167240 CTGGACTCAGCGTGAGGATCTGG + Intronic
1158411286 18:57208316-57208338 TGGGCCACCGCCTGGGGCTCAGG + Intergenic
1159655893 18:71030220-71030242 CTGGCCTCACCCAGTGGCTCAGG + Intergenic
1160505369 18:79423660-79423682 CTGCCCGCCGGGTGAGGCTCAGG - Intronic
1160564472 18:79778512-79778534 GTGGCCTCGGCCTCAGCCTCCGG - Intergenic
1160668121 19:343055-343077 CTGTCCTCGGCCTGAGGATCTGG - Intronic
1160732714 19:648557-648579 GCGGCCTCCGGCTGAGGCTGTGG - Intronic
1160910404 19:1471344-1471366 TTGCCCTCCACCCGAGGCTCTGG + Exonic
1161369456 19:3902425-3902447 CTGTCCTCTGCCTGAATCTCTGG + Intronic
1161736145 19:5993156-5993178 CTGGTTTCTGCCTTAGGCTCTGG - Exonic
1162369437 19:10270141-10270163 CTGCCCTACGCGCGAGGCTCCGG - Intergenic
1163134060 19:15296525-15296547 CTAGCCTCTGCCTCAGGCTTTGG - Intronic
1164736224 19:30543460-30543482 CTGGACTCTGCCTGAGACTCAGG - Intronic
1165941050 19:39415009-39415031 ATGGCCTCCCCCCGAGGTTCTGG + Exonic
1166339409 19:42128683-42128705 CTGGGCTCAGGCTGAGGCTGAGG - Intronic
1166425121 19:42670624-42670646 CAGGCCTCCGCCTAAAGGTCTGG + Intronic
1167792639 19:51690967-51690989 CTCGCCCCCGCCTGAGGGTCTGG + Intergenic
1168145004 19:54415767-54415789 CTGAGCTCCGCCGGAGGCTGGGG + Intronic
1168238248 19:55076583-55076605 CTGGCTTCCTCCTGAGTGTCGGG - Intronic
925545191 2:5008442-5008464 CTGGCCTGCCTGTGAGGCTCTGG - Intergenic
926198238 2:10776362-10776384 CTGGGCTCCGGCTGAGCCTGCGG + Intronic
927921767 2:26977901-26977923 TTGGCCTCCTCCTGAGGATCCGG + Intronic
928366243 2:30705710-30705732 CTGCCACCCGCCTGAGGCTGTGG + Intergenic
928928025 2:36598033-36598055 CCCGCCTCCGCCCCAGGCTCGGG + Exonic
929600921 2:43204099-43204121 CAGGCCACGGCCAGAGGCTCAGG + Intergenic
929600924 2:43204109-43204131 CTGTCCTCTTCCTGAGCCTCTGG - Intergenic
935377251 2:102411907-102411929 CTGGCCTCTGGTTGAGGATCTGG + Intergenic
937343019 2:121104019-121104041 CTGTCTTTCGCCTCAGGCTCTGG - Intergenic
938696176 2:133837410-133837432 CTGACCTCCTCCTGATGCCCTGG - Intergenic
938876019 2:135531866-135531888 CTGGCCCGCGGCTGCGGCTCCGG + Intronic
939881150 2:147632787-147632809 CTGGCCTCTGTCTGAAGGTCAGG - Intergenic
940516739 2:154693095-154693117 CTGGCCTCTGCCTGAGGATTCGG - Intergenic
942849079 2:180461486-180461508 CTGGCCAGCGACAGAGGCTCGGG + Intergenic
944049399 2:195450414-195450436 CTGCCCTCAGCCTGTGTCTCAGG + Intergenic
945302573 2:208227942-208227964 CTGCCCTCGGCCAGTGGCTCCGG + Intergenic
946434306 2:219641778-219641800 CTGGGCTCTGCCTGAGGCCCAGG - Exonic
948826890 2:240577301-240577323 CTGGCCTCCCTCTGAGGAGCTGG - Intronic
948846577 2:240685707-240685729 CTGGGCTCTGCCAGAGGCTGAGG - Intergenic
948847284 2:240689027-240689049 CTGGGCTCTGCCAGAGGCTGAGG + Intergenic
1169609111 20:7359289-7359311 CTAGCCTTCCCTTGAGGCTCAGG + Intergenic
1170558338 20:17533668-17533690 CAGGGCTCAGCCTGAGGCCCTGG + Intronic
1171948661 20:31401344-31401366 CTGGCCTCCTCCTTATACTCAGG - Intergenic
1172205255 20:33158824-33158846 GTGCCCCCTGCCTGAGGCTCCGG + Intergenic
1172609604 20:36240178-36240200 ATGGCCTCCACCTCAGACTCTGG - Exonic
1173690856 20:44960125-44960147 CTGGCCGCCGCGCGAGGCCCGGG + Intronic
1175403882 20:58715021-58715043 CTGGGCTCCGGCTGGTGCTCAGG + Intronic
1175931839 20:62497214-62497236 CTGGCCCTCCCCTGAGGCCCGGG - Intergenic
1175997278 20:62817422-62817444 CCGGGCTCCGCCCGAGGCTTTGG + Intronic
1176050113 20:63114555-63114577 CAGGCCTCAGGCAGAGGCTCTGG + Intergenic
1176254061 20:64141449-64141471 CTGGCCTCCTCCTGGGACCCGGG - Intergenic
1176254089 20:64141513-64141535 CTGGCCTCCTCCTGGGACCCGGG - Intergenic
1176625346 21:9087560-9087582 CTGGCTTCACGCTGAGGCTCTGG - Intergenic
1180214320 21:46314943-46314965 CTGGCCTGAGCCTGATGCTGGGG - Intronic
1180945229 22:19688887-19688909 CTGCTCTCCGCCTGCAGCTCTGG + Intergenic
1181008954 22:20029029-20029051 CTGCTCTCTGCCTGTGGCTCTGG + Intronic
1183617174 22:38953069-38953091 CTGGCTTCCGCCTCTGGCTTGGG - Intronic
1183645446 22:39123744-39123766 CTGGCCTCCTCCAGTGGCTTCGG - Intronic
1184992604 22:48180823-48180845 CTGCCCTGCATCTGAGGCTCAGG - Intergenic
1185058770 22:48594669-48594691 CTGGCCTCTGCAGAAGGCTCTGG - Intronic
1185119481 22:48957503-48957525 CTGGCCGCCTCCTGAACCTCAGG + Intergenic
1185219370 22:49621904-49621926 CTGGCCGTGGCCTGAGGCTGGGG - Intronic
1185322239 22:50206908-50206930 CTGTCCCCAGCCTCAGGCTCAGG - Intronic
950708408 3:14797995-14798017 CTGGCCTCAGCCTGATCTTCAGG - Intergenic
952464064 3:33562346-33562368 CTGGCCTTCTCCTGAGGGCCAGG + Intronic
954990878 3:54839735-54839757 CCTGCCTCCACCTGAGGCCCAGG - Intronic
955500160 3:59575238-59575260 CTGGCCTCTGCTGGAGGCTTAGG - Intergenic
956662884 3:71616693-71616715 AGGGCCTCCTCCAGAGGCTCAGG + Intergenic
956736952 3:72245460-72245482 CTGGCATCTGTCTGGGGCTCTGG - Intergenic
957970379 3:87375421-87375443 CTGCCCGGGGCCTGAGGCTCCGG - Intergenic
960054650 3:113268462-113268484 CTGGCCTCAGCCTTGGCCTCTGG - Intronic
961415202 3:126752020-126752042 CTGGCCTCATCCTAAGACTCTGG - Intronic
962305267 3:134280665-134280687 TTGGCCTCCGCATGTGGCTTGGG + Intergenic
963558251 3:146824806-146824828 CTGGCTCCTGCCTAAGGCTCTGG - Intergenic
967904282 3:194487523-194487545 CTGTCCTCCGCCTGCGGCCGGGG - Intronic
968445822 4:651521-651543 CGGGCCTCCACCTGCGGCTCTGG + Intronic
969296190 4:6271677-6271699 CAGGCATCCGAGTGAGGCTCAGG - Intronic
969379214 4:6783083-6783105 CGGGCCGCCGCCGGGGGCTCCGG + Intronic
969510030 4:7612466-7612488 CAGGCCTCTGCCTGAGTCACCGG + Intronic
969651643 4:8471626-8471648 CAGGCCTCCGCCTGTGGGGCAGG - Intronic
969704994 4:8786835-8786857 CTGGCGTCCGCCTGGCCCTCTGG + Intergenic
969913074 4:10462590-10462612 CAGGCCTCCGCCTTAGGCGCTGG - Intergenic
982202437 4:152973658-152973680 CTTGGCTCCGCCTGCAGCTCTGG - Intronic
984081460 4:175253759-175253781 AGGGCCTCAGCCTGAGGCTTGGG - Intergenic
986191786 5:5503169-5503191 CTGGTCTCCACCGCAGGCTCTGG - Intergenic
990773411 5:59277168-59277190 ACGGCATCCGCCAGAGGCTCTGG + Intronic
993810326 5:92468177-92468199 CTGGCCTCCCACTGAAGCCCTGG - Intergenic
997880042 5:137581343-137581365 CTGGCCTCCCCAGGAGGCTTAGG - Intronic
997890928 5:137676096-137676118 CTGGACTCTCCCTTAGGCTCAGG - Intronic
999731500 5:154479107-154479129 CTGGCGTCCGCCTTGGGCCCGGG + Intergenic
1000024618 5:157347886-157347908 CTGGCCTCCGCCTCCGAGTCTGG - Intronic
1000209347 5:159096300-159096322 ATGGCCTCACCCTGGGGCTCCGG - Intronic
1000293679 5:159894203-159894225 CTGGTCTAGGCCTGAGGCTATGG + Intergenic
1001579907 5:172791481-172791503 CTGGCATCAGCCTTAGGCTCTGG - Intergenic
1002284570 5:178153765-178153787 CACGCCTCCGCCTGAGCCTCGGG + Exonic
1002527112 5:179821021-179821043 TCGGCTTCCGCCTCAGGCTCGGG - Exonic
1002785011 6:393510-393532 CTTTCCTCCTCCTGCGGCTCCGG - Intronic
1003331097 6:5129383-5129405 CTGGCTTCTTCCCGAGGCTCTGG + Intronic
1004260635 6:14104531-14104553 GTAGCCTCTGCCTGGGGCTCAGG - Intergenic
1005315589 6:24599835-24599857 GTGGCCTCCCCCACAGGCTCTGG - Intronic
1005475341 6:26202461-26202483 CAGGCCTCCGCCTGAAGGTCTGG + Intergenic
1006092119 6:31634290-31634312 CTGGACTCTGCCTGAGGGCCTGG - Exonic
1007747991 6:44054987-44055009 CTGGGCTCTGCCTTGGGCTCAGG - Intergenic
1008342778 6:50387864-50387886 CTGGTTTCCTCCTGAGGGTCAGG - Intergenic
1010662154 6:78583798-78583820 CTGGCCGCTGCCTGAGGCAGAGG + Intergenic
1014844437 6:126258241-126258263 CGGGCCTCCTCCTGCGGCCCTGG + Intergenic
1015054447 6:128883088-128883110 CGGGCCGCCGCCTGAGGGTGGGG - Intergenic
1015302361 6:131668327-131668349 CTCGCCCCCCCCTGAGGATCTGG + Intronic
1015496805 6:133891265-133891287 CTGGCCTCCTTCTGAGGCGGTGG - Intronic
1019299380 7:295792-295814 CTGGCCTCCGCGCGGGGGTCTGG + Intergenic
1019486882 7:1293469-1293491 CTGCCCTCCTTCTGAGGCTGTGG + Intergenic
1021409090 7:20308072-20308094 CTGGGCTCCTCCCGTGGCTCTGG + Intergenic
1022083874 7:27048198-27048220 CACGCCTCCTCCTGAGCCTCGGG - Intergenic
1022701386 7:32763206-32763228 TTGGCGTCAACCTGAGGCTCTGG - Intergenic
1022936890 7:35186981-35187003 GTGGCGTCAACCTGAGGCTCTGG - Intergenic
1023983694 7:45083349-45083371 GTGGCCACAGCCAGAGGCTCTGG + Exonic
1024505499 7:50158501-50158523 CTGGCCTCTGGGTGAGGCCCAGG + Intronic
1024613858 7:51090637-51090659 CTGGCCTTTGCCTGTGGCACTGG - Intronic
1026125616 7:67577139-67577161 CTGGCCTCCTGCAGAGCCTCTGG + Intergenic
1028585459 7:92447523-92447545 CTGGCCTCCGCCTGCGGAGCCGG + Exonic
1029203706 7:98855766-98855788 CTGGTCACCGGCTCAGGCTCTGG + Intronic
1029577303 7:101411967-101411989 CTGGTCTCTGACTCAGGCTCGGG + Intronic
1029620685 7:101688349-101688371 CTGGCCTCGGCCAGAGGAGCAGG - Intergenic
1030082297 7:105788488-105788510 CTTGTCTCAGCCTGAGGCTGTGG - Intronic
1035102930 7:156416261-156416283 CTGGTCCCCACCTGAGGCCCTGG + Intergenic
1035854268 8:2957454-2957476 CTGGCTCCCTCCAGAGGCTCTGG + Intronic
1037572635 8:20171600-20171622 CTAAGCTCCACCTGAGGCTCTGG + Intronic
1038546385 8:28428667-28428689 CTGGCCTCCCCCTGAGTCAGTGG - Exonic
1039093380 8:33856854-33856876 CTGGTCTCCGACTCGGGCTCAGG + Intergenic
1039790274 8:40870262-40870284 GTGGCCTCCCCTGGAGGCTCTGG + Intronic
1040323055 8:46328145-46328167 CAGGCCTCTGCCTGTGGCTTTGG - Intergenic
1040842895 8:51803556-51803578 CTGGGCTCCTCCTGAGTCTTCGG + Intronic
1041118784 8:54565880-54565902 GTTGGCTCCTCCTGAGGCTCTGG + Intergenic
1041781232 8:61579715-61579737 GTGGCCTCCTTCTCAGGCTCTGG - Intronic
1042096092 8:65217531-65217553 TTGGCCTCTGCCTGAAGGTCAGG + Intergenic
1042679181 8:71361840-71361862 CTGGCCGCTGCCGCAGGCTCGGG + Exonic
1045655689 8:104384055-104384077 CTTGCCTGCCTCTGAGGCTCTGG + Intronic
1049266067 8:141668530-141668552 CTGGCCTCAGCCTCAGGGCCTGG + Intergenic
1049497857 8:142945083-142945105 CTGCCCTCCTGCTGAGGCCCAGG + Intergenic
1050701940 9:8349687-8349709 CTGGCCTCAGCCTGAAGCACAGG - Intronic
1053411702 9:37920040-37920062 TTGGCCTCAGCCTGAGTGTCAGG - Intronic
1057270044 9:93645492-93645514 CAGGCCTCCTCCTGTGGCTGTGG + Intronic
1057880866 9:98791792-98791814 CTGAACTCTGTCTGAGGCTCCGG + Intronic
1057891291 9:98871929-98871951 CTGGCCCCTGACTGAGGCTGTGG + Intergenic
1060050920 9:120377563-120377585 CCGTGCTCCGTCTGAGGCTCGGG + Intergenic
1061250606 9:129424255-129424277 CTGGGCTCCACCCGAGACTCAGG + Intergenic
1061893057 9:133632906-133632928 CTGTCCCTCGCCTGTGGCTCAGG - Intergenic
1061986646 9:134134201-134134223 CTTGCCTCAGCCTCAGCCTCAGG + Intergenic
1062565863 9:137163722-137163744 CTGGCCAGCAACTGAGGCTCTGG + Intronic
1062624123 9:137435328-137435350 CTGGCCTCCACCTGGGGCCCAGG + Exonic
1062659140 9:137619195-137619217 CCGGCCTCGGCCTGAGGCGGCGG - Intronic
1203748520 Un_GL000218v1:58021-58043 CTGGCTTCACGCTGAGGCTCTGG - Intergenic
1186788301 X:12973688-12973710 CTGGCCTCCGAATGGGGCACTGG - Intergenic
1189373345 X:40447154-40447176 CTGGCATACTCCTGAGGCTTGGG + Intergenic
1189498446 X:41530682-41530704 CTGACCTCAGGATGAGGCTCTGG - Intronic
1190344707 X:49326988-49327010 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190345800 X:49336545-49336567 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190346904 X:49346095-49346117 CCCGGCTCCGCCAGAGGCTCAGG - Intergenic
1190348153 X:49537122-49537144 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190349254 X:49546678-49546700 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190350358 X:49556234-49556256 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190351460 X:49565793-49565815 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190352560 X:49575346-49575368 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190353661 X:49584894-49584916 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190354763 X:49594416-49594438 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190355868 X:49603966-49603988 CCCGGCTCCGCCAGAGGCTCAGG - Intronic
1190640879 X:52482050-52482072 TTGGGCTCATCCTGAGGCTCTGG + Intergenic
1190646793 X:52530815-52530837 TTGGGCTCATCCTGAGGCTCTGG - Intergenic
1192149001 X:68700320-68700342 GTGGTCTCCACCTGAGGCCCAGG + Intronic
1197421058 X:126237630-126237652 AGAGCCTCCTCCTGAGGCTCGGG - Intergenic
1197773499 X:130105689-130105711 CTTTCCTCCACCTGAAGCTCTGG + Intronic
1199716828 X:150512617-150512639 CCGGGCTCTGCCTGAGGCTCTGG - Exonic
1200134167 X:153866863-153866885 CTGGCCTCCTCCAGCCGCTCCGG - Exonic