ID: 1123020930

View in Genome Browser
Species Human (GRCh38)
Location 14:105397635-105397657
Sequence GAGGCACTGAACCAGGACAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 297}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123020930_1123020943 10 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020943 14:105397668-105397690 GGGGCAGGAGAGGGGCCTCTGGG 0: 1
1: 1
2: 16
3: 77
4: 699
1123020930_1123020946 22 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020946 14:105397680-105397702 GGGCCTCTGGGTGAGAGCTGGGG 0: 1
1: 0
2: 2
3: 61
4: 454
1123020930_1123020935 -9 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020935 14:105397649-105397671 CAGTGCCTCGGCCAGAGCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 277
1123020930_1123020945 21 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020945 14:105397679-105397701 GGGGCCTCTGGGTGAGAGCTGGG 0: 1
1: 1
2: 3
3: 35
4: 386
1123020930_1123020941 2 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020941 14:105397660-105397682 CCAGAGCTGGGGCAGGAGAGGGG 0: 1
1: 2
2: 17
3: 166
4: 1196
1123020930_1123020939 1 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020939 14:105397659-105397681 GCCAGAGCTGGGGCAGGAGAGGG 0: 1
1: 0
2: 28
3: 186
4: 1216
1123020930_1123020942 9 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020942 14:105397667-105397689 TGGGGCAGGAGAGGGGCCTCTGG 0: 1
1: 1
2: 10
3: 129
4: 896
1123020930_1123020936 -5 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020936 14:105397653-105397675 GCCTCGGCCAGAGCTGGGGCAGG 0: 1
1: 0
2: 6
3: 67
4: 640
1123020930_1123020938 0 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020938 14:105397658-105397680 GGCCAGAGCTGGGGCAGGAGAGG 0: 1
1: 3
2: 23
3: 241
4: 1434
1123020930_1123020944 20 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020944 14:105397678-105397700 AGGGGCCTCTGGGTGAGAGCTGG 0: 1
1: 0
2: 5
3: 35
4: 339
1123020930_1123020947 23 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020947 14:105397681-105397703 GGCCTCTGGGTGAGAGCTGGGGG 0: 1
1: 0
2: 0
3: 50
4: 454
1123020930_1123020934 -10 Left 1123020930 14:105397635-105397657 CCAGTGTCCTGGTTCAGTGCCTC 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1123020934 14:105397648-105397670 TCAGTGCCTCGGCCAGAGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123020930 Original CRISPR GAGGCACTGAACCAGGACAC TGG (reversed) Exonic
901240660 1:7691297-7691319 CAGGCAGTGAATCAGGCCACAGG + Intronic
901469626 1:9447358-9447380 GAGGTACTGAACCAGCTCACCGG + Intergenic
904192302 1:28755051-28755073 GAGGGCCTGAACCAGGACAGTGG + Intronic
905547755 1:38813310-38813332 GAAGCCCTGAACCAGTGCACTGG - Intergenic
905654085 1:39674919-39674941 AAGGGACTGAACCAGGAGTCTGG - Intergenic
906214842 1:44032571-44032593 GAGGCACTGAACAAGATAACAGG + Intergenic
906475693 1:46167869-46167891 GAGTCACTGCACCCGGCCACAGG - Intronic
907486052 1:54778898-54778920 GAGACACAGAACAAGGTCACAGG - Intergenic
909393938 1:75148824-75148846 GAGCCACTGTACCTGGCCACAGG + Intronic
911189360 1:94932512-94932534 GAGCCACTGCACCAGGCCAGGGG - Intergenic
912846439 1:113079058-113079080 GAGCCACCGCACCAGGTCACAGG - Intronic
914678874 1:149925059-149925081 GAGAGACTGAACTAGGGCACTGG + Intronic
915366654 1:155320745-155320767 GCTGCACGGAACCAGGACCCAGG + Intergenic
915494854 1:156274817-156274839 GACACACTCATCCAGGACACAGG + Intronic
916026803 1:160840302-160840324 ATGCCACTGAACTAGGACACTGG - Intronic
917536145 1:175876064-175876086 CAGGCGCTGACCCAGTACACTGG + Intergenic
919790866 1:201290128-201290150 GAAGCAGTGTGCCAGGACACTGG + Intronic
921081386 1:211741068-211741090 GAATCACTGAACCGGGACCCGGG + Intergenic
921130935 1:212219146-212219168 GAGCCACTGAAACAGAACAACGG + Intergenic
922203929 1:223430411-223430433 GAGGCCCAGAGCCAGCACACTGG - Intergenic
922210597 1:223483651-223483673 CAGGCACTGACCCAGGCCCCAGG + Intergenic
922762016 1:228139200-228139222 GAGCCACTGCACCTGGCCACGGG - Intergenic
922875968 1:228940197-228940219 AAGGCACTGGACAAGGACACAGG + Intergenic
923349191 1:233087034-233087056 GAGGCACAGAATCAGGGAACAGG + Intronic
924811824 1:247409684-247409706 GAGGCAAAGAACCAAGACAAGGG + Intergenic
1064436704 10:15317108-15317130 CAGTCACGGAAACAGGACACAGG + Intronic
1064614381 10:17137545-17137567 GAGGCACTGAGCCCGGCCAGTGG - Intergenic
1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG + Intronic
1065735220 10:28745328-28745350 GGGTCACTGAACGAGGAGACGGG + Intergenic
1067091502 10:43267866-43267888 GAACCACTAAAGCAGGACACAGG + Intergenic
1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG + Intergenic
1067404368 10:46007871-46007893 GAGCCACTGCACCTGGCCACTGG + Intronic
1068682771 10:59838156-59838178 GAGGCATTGACCCAGAATACTGG - Intronic
1069033766 10:63627251-63627273 GAGCCACTGCACCCGGTCACAGG - Intergenic
1069483443 10:68804875-68804897 GAGGCAATGAACCAGAACAGTGG + Intergenic
1069769812 10:70891101-70891123 GCTGCACTGAGCCATGACACAGG + Intergenic
1069939854 10:71947899-71947921 GAGGGTCTGATCCAGGACATAGG - Intergenic
1069959636 10:72072264-72072286 GGGGCACAGAGTCAGGACACAGG + Intronic
1070456806 10:76625039-76625061 GAGGCAGTGGACCAGGACTGGGG + Intergenic
1070502260 10:77083064-77083086 GAGGCAGTAAACCAAGCCACCGG + Intronic
1070814271 10:79313153-79313175 GAGGCTCTGGACCAGGAAGCAGG - Exonic
1071333974 10:84586814-84586836 GAGGCACTGAGTCAGGGCTCAGG - Intergenic
1073168634 10:101481883-101481905 GAAGCAATGAACCAGAAGACAGG - Intronic
1074907532 10:117878257-117878279 GAGGTACAGAACCTGGACTCTGG + Intergenic
1075676196 10:124297237-124297259 GAGGCCCTGAACCAAGCCAGAGG - Intergenic
1077338689 11:2016588-2016610 GACGCCCTGAGCCAGGAGACAGG + Intergenic
1077607181 11:3620205-3620227 GAGTCACTGAGCCAGGACTATGG + Intergenic
1078191252 11:9093873-9093895 GAGGCCATGAACCAGGCCTCAGG + Intronic
1078487095 11:11733611-11733633 GAGCCTCTGAACCATGACAGTGG + Intergenic
1078685122 11:13522730-13522752 AAGGCACTGAACCAGGTGATTGG + Intergenic
1079452783 11:20611618-20611640 GAGCCACTGAACAAGGAGATAGG - Intronic
1080360632 11:31509540-31509562 GAGACCCTCAACCAGGACACAGG + Exonic
1081787636 11:45758447-45758469 GGAGCACTGAACCAGGAGTCAGG - Intergenic
1083225792 11:61283681-61283703 GAGCCACTGCACCTGGCCACTGG + Intronic
1083308195 11:61771671-61771693 GAGGCAAGGAACCAGGGCCCGGG - Exonic
1083351445 11:62032099-62032121 AAGGCACCGAACCAGGAGATAGG + Intergenic
1085026109 11:73237610-73237632 GAGCCACTCCACAAGGACACAGG + Intergenic
1085033305 11:73285703-73285725 CAGGCAATGAAACAGGACAGAGG + Intronic
1085350878 11:75797321-75797343 GAGGCACTCACCCATGACGCAGG - Exonic
1086168504 11:83808297-83808319 AAGGCACTGAACTTGGCCACAGG - Intronic
1086202237 11:84217881-84217903 GAGCCACTGCACCAGGCCACAGG - Intronic
1087192517 11:95269937-95269959 CAGGCAGTGAACCAGCTCACAGG + Intergenic
1088984346 11:114892402-114892424 GAGACACTGAATGAGGACAGAGG - Intergenic
1089321163 11:117627596-117627618 GAGGAGCTGAACCAAGCCACGGG - Intronic
1089873922 11:121701749-121701771 GAGGACCTGAACCAGGGCAGCGG + Intergenic
1090880551 11:130828398-130828420 GAGGCACCAAACAAAGACACTGG + Intergenic
1202821673 11_KI270721v1_random:71770-71792 GACGCCCTGAGCCAGGAGACAGG + Intergenic
1091427557 12:404481-404503 GAGCCACTGAGCCAGGCCTCGGG - Intronic
1093718803 12:22414312-22414334 GAGCCACTGCACCTGGACTCAGG - Intronic
1094048034 12:26188552-26188574 GAATAACTCAACCAGGACACAGG - Intronic
1094199318 12:27780448-27780470 GAGGCCCTGAGCCAGGAGGCCGG + Exonic
1094345178 12:29460471-29460493 CAGGCACAGAGCCAGGACATGGG - Intronic
1096474290 12:51898703-51898725 AGGGCACTGAACCAGGAGTCAGG - Intergenic
1096688818 12:53307003-53307025 GAGGCCCTGGACCAGGTCAGTGG + Exonic
1097751120 12:63354041-63354063 GAAGCAGTGAAGCATGACACAGG - Intergenic
1098889851 12:75998571-75998593 GAGGCAATTAACCTGAACACAGG + Intergenic
1101523078 12:105502892-105502914 GAGACACTGAGCCAGAGCACTGG - Intergenic
1101895001 12:108749721-108749743 GAGCCACTGTACCAGGCCAGTGG - Intergenic
1102246302 12:111358501-111358523 GAGCCACTGCACCTGGCCACAGG + Intergenic
1102447611 12:113015534-113015556 AAGACCCTCAACCAGGACACAGG - Intergenic
1102852903 12:116267416-116267438 GAGGCAGTTAACCAGGAGATTGG - Intronic
1103932635 12:124458686-124458708 GAGGCACAGAAACAAAACACAGG + Intronic
1104437870 12:128770099-128770121 GAGACAATGAACCAGGAAAGAGG - Intergenic
1104809468 12:131611747-131611769 GGGGCACAGAGCCAGGGCACAGG - Intergenic
1105491522 13:20893052-20893074 GAGGCCCTGTGACAGGACACAGG + Intronic
1105503449 13:20991149-20991171 GAGGCAATGTGCCAGGAGACTGG + Intronic
1106143652 13:27033258-27033280 GAGGGACTGAGGCAGGAGACTGG + Intergenic
1107315219 13:39124098-39124120 GAGCCACAGAACCATGAGACAGG - Intergenic
1107721751 13:43256215-43256237 GAGGAAATGCTCCAGGACACTGG + Intronic
1107952409 13:45475486-45475508 GAGCCACTGAACCCGGTCATTGG + Intronic
1108023217 13:46150722-46150744 GAGACACTGCACTAGGACTCTGG + Intronic
1109516767 13:63453273-63453295 GAGGAAATGCACCAGGACACTGG + Intergenic
1112385860 13:98939145-98939167 GAGACACTGAGTCAGGACAGGGG + Intronic
1112549161 13:100403757-100403779 GAAGCACTGTAGCAGGACTCTGG - Intronic
1112794590 13:103042628-103042650 GAGACATTGAAAGAGGACACAGG - Intergenic
1115813046 14:37131956-37131978 GAGCCACTGCACCAGCCCACGGG + Intronic
1116204696 14:41848774-41848796 GAGCCCCTCAACCAAGACACTGG + Intronic
1117472905 14:56064398-56064420 GAGTCACTGAGCTAGGAGACAGG + Intergenic
1118701497 14:68438231-68438253 GAGGGCCTGAACCAAGACAGTGG + Intronic
1119191154 14:72682910-72682932 GATGCACTGAGCCAGGTAACTGG - Intronic
1119803257 14:77464092-77464114 GAGCCACTGCACCTGGCCACTGG - Intronic
1120867938 14:89311540-89311562 GAGCCACTGCACCCGGCCACAGG - Intronic
1121661162 14:95636113-95636135 GAGGAAATGGCCCAGGACACAGG + Intergenic
1123020930 14:105397635-105397657 GAGGCACTGAACCAGGACACTGG - Exonic
1123757692 15:23409680-23409702 GAGCCACTGTACCCGGCCACTGG - Intergenic
1126579704 15:50231708-50231730 GAGCCACTGAAACAGAACAAAGG + Intronic
1128022615 15:64405436-64405458 GAGCCACTGCACCCGGCCACTGG + Intronic
1128065711 15:64763232-64763254 AAGGCTCTGAATAAGGACACAGG + Intronic
1128805565 15:70528477-70528499 CAGGCACTGACCCAGGGCACAGG + Intergenic
1129269809 15:74413646-74413668 GAGGCAGGGAATCAGGACCCAGG + Intronic
1129622405 15:77160391-77160413 GAGCCACTGAACCTGGCCAGGGG - Intronic
1129832958 15:78682477-78682499 GAGGCATTGAAACAGGAACCTGG + Intronic
1130561456 15:84962687-84962709 GAGTCACTGCACCAGGCCAAGGG + Intergenic
1130681397 15:86000132-86000154 TGGGCACTGAACCAGGTCTCTGG - Intergenic
1130976247 15:88777589-88777611 GAGCCACTGCACCCGGCCACTGG + Intergenic
1134421152 16:14091184-14091206 GAGGACCTGAACTAGGGCACTGG + Intronic
1134458641 16:14413080-14413102 GAGCCACTGCACCCGGCCACTGG + Intergenic
1134801526 16:17089269-17089291 GAGGATCTGTATCAGGACACTGG - Intergenic
1134803972 16:17108993-17109015 GAGGCACTGAAGCTGCACAATGG - Exonic
1136032242 16:27511876-27511898 GAGGCACCGAACCATGACGTCGG + Exonic
1136369490 16:29827095-29827117 GAGGAACAGAGCCAGGACATCGG + Intronic
1137249988 16:46734327-46734349 GAGCCACTGCACCTGGCCACAGG - Intronic
1137537197 16:49336419-49336441 GAGGCTCTGAGACAGGACCCAGG - Intergenic
1138884109 16:61054206-61054228 GAGCCACTGAACCCGGCCACTGG - Intergenic
1141797313 16:86283982-86284004 GAGGCACTGCCCCAGGCCAAGGG + Intergenic
1142232530 16:88906533-88906555 GGGCCATTGCACCAGGACACTGG - Intronic
1144766567 17:17736236-17736258 GAAGGAATGAACCAGGACAGAGG - Intronic
1144849654 17:18237635-18237657 CAGGCACTGCACCAGGACACGGG - Exonic
1146084933 17:29818940-29818962 GAGCCACTGCACCTGGCCACTGG - Intronic
1147235894 17:39057222-39057244 GAGGTGCTGAAGCAGGACTCTGG - Intergenic
1147402597 17:40189976-40189998 GAGGCACTGGTCTAGGACTCAGG + Intronic
1147507906 17:41038688-41038710 GAGCCACTGAGCCCGGCCACTGG + Intergenic
1148426195 17:47598862-47598884 GAGCCACTGCACCAGGCCATTGG - Intronic
1148428205 17:47619267-47619289 GAGCCACTGCACCTGGCCACAGG - Intronic
1149990861 17:61382905-61382927 GAGGCACTGAAGCCTGAAACAGG + Intronic
1150441983 17:65198538-65198560 GAGCCACTGCACCAGGACTGTGG + Intronic
1150657627 17:67050757-67050779 GATGCCCTTAACCAGAACACTGG + Intronic
1152297878 17:79478924-79478946 GAGGCAATGAACCAGGGCTGAGG + Intronic
1152419397 17:80183972-80183994 GAGGAGCTGAACCAGGAAAAGGG + Exonic
1152803018 17:82340369-82340391 GAGGCACAGAGGGAGGACACGGG - Intergenic
1153664524 18:7357120-7357142 GAGCCACTGAGCCAGGCCAAGGG - Intergenic
1154220463 18:12448965-12448987 GAGACACTGAACCAGGGCACTGG + Exonic
1154968578 18:21383996-21384018 GAGCCACTGCACCCGGCCACTGG + Intronic
1156262591 18:35459117-35459139 GAGTCACTGTTCCAGGCCACAGG + Intronic
1156503614 18:37575414-37575436 GAAGCAGTGACCCAGGATACAGG - Intergenic
1158549939 18:58427134-58427156 GAGGAACTGAATGAGGCCACTGG + Intergenic
1159951538 18:74487702-74487724 GACGCACTGGACTAGCACACTGG + Intergenic
1161512203 19:4678048-4678070 GAGGCAGTGAGACAGGACCCTGG + Intronic
1161701881 19:5800264-5800286 AAGGGACTTACCCAGGACACTGG - Intergenic
1162233353 19:9284990-9285012 GAAGCACTGCCCCAGGACACTGG - Intergenic
1162305451 19:9870519-9870541 CAGGCACTGAACCAGGATGTAGG + Intronic
1163474234 19:17515734-17515756 GAGGCTTTGAAACAGGACAATGG + Intronic
1163613798 19:18314574-18314596 GAGGCACTGACACAGGCCACAGG + Intronic
1163746808 19:19053681-19053703 GAGGCGCTGCACCAGGAAGCAGG - Intronic
1164073180 19:21788206-21788228 TAGGCACTGGGCCAAGACACTGG + Intergenic
1164426499 19:28146470-28146492 CAAGCATTGTACCAGGACACAGG - Intergenic
1164982752 19:32626595-32626617 GGGGCACAGCACCAGGAGACAGG + Intronic
1165164609 19:33842962-33842984 GAGGCAGTGAATTAGAACACAGG + Intergenic
1165429445 19:35764171-35764193 GAGTCACTGAGCCAGGACCATGG - Intronic
1165503100 19:36205732-36205754 GAGGGCCTGACCCAGGACATTGG + Intronic
1167035136 19:46990744-46990766 GAGTCAGTGACCCAGGACTCGGG - Intronic
1167254112 19:48417027-48417049 GAGCCACTGCACCCGGACAAGGG + Intronic
1167312227 19:48743640-48743662 AAGGCACAGGACCAGGACGCAGG + Intronic
1167577409 19:50324406-50324428 GGGGCCCTGAAATAGGACACAGG - Intronic
1168140581 19:54384141-54384163 GAGCCACTGCACCCGGCCACAGG - Intergenic
925133821 2:1512707-1512729 GAGGCACTGGGCCAGGCCGCCGG + Intronic
927148684 2:20183498-20183520 GAAGCAGTAAACCAGGACAGTGG + Intergenic
927202072 2:20584100-20584122 GTGGCACTGAGCGAGGACACAGG + Intronic
929657081 2:43744581-43744603 AAGCCACTGCACCCGGACACAGG - Intronic
930047233 2:47183442-47183464 GAGCCACTGCACCAGGCCAGGGG + Intergenic
932635043 2:73380673-73380695 CAGGCACTGTACTAGGAAACAGG - Intergenic
933745313 2:85566441-85566463 GAGCCACTGCACCAGGCCAAAGG + Intronic
934051564 2:88215494-88215516 GAGGCACTCTACCAGGCCCCCGG + Intergenic
934062251 2:88306042-88306064 GAGGCCCTGGACCAGGGCAATGG - Intergenic
936146199 2:109981941-109981963 GAGGGGCTGGCCCAGGACACAGG - Intergenic
936198492 2:110389538-110389560 GAGGGGCTGGCCCAGGACACAGG + Intergenic
937074804 2:119095424-119095446 GAGCCACTGATCCAGGATAGTGG - Intergenic
942485286 2:176433003-176433025 GAGGGAATAAACCAGGAAACGGG - Intergenic
943755524 2:191553008-191553030 AATGCACTGAGCCAGAACACAGG + Intergenic
946354424 2:219176326-219176348 GAGGAACTGAAACAGGGCAGGGG + Exonic
946413126 2:219525675-219525697 GAGGCTTTGAACCTGGATACTGG + Intronic
947543518 2:230994626-230994648 GAGCCACCGCACCAGGCCACTGG + Intergenic
948103421 2:235393432-235393454 AAGGCACTCAACCACGCCACAGG + Intergenic
948915702 2:241034222-241034244 GAGGGAATGAAACAGGACAATGG + Intronic
948975443 2:241460880-241460902 GAGGCACAGCACCTGGGCACTGG + Intronic
1169956984 20:11114559-11114581 GAGGACATGAACCAGGACATTGG - Intergenic
1171275689 20:23855183-23855205 GAGGGCCTGCACCAGGAGACGGG - Intergenic
1173822082 20:46026005-46026027 CATCCACTGAACCAGGACAAGGG - Intronic
1174604728 20:51752816-51752838 GAGACACTGTACCCGGCCACAGG - Intronic
1175054995 20:56190016-56190038 GAGGCCCTGTATCAGGACAAGGG + Intergenic
1175093692 20:56524828-56524850 GAGGCACAGAAGCAGGACCAGGG - Exonic
1175094882 20:56533361-56533383 GAGGCACAGAAGCAGGACCAGGG - Exonic
1176299285 21:5090988-5091010 GAGGGGCTGGAGCAGGACACAGG - Intergenic
1178666294 21:34549901-34549923 GAGGCACTGAACACAGACCCAGG + Intronic
1178781051 21:35603740-35603762 GAGGCCCTGAGCCAGGGCCCCGG + Intronic
1178973303 21:37200452-37200474 GAGGCACTGAACACTGACACGGG - Intronic
1179145675 21:38765464-38765486 AAGGCACTTAAACAGGACATGGG + Intergenic
1179632029 21:42684564-42684586 GAGGCCAGGAACCAGGACACAGG + Intronic
1179857741 21:44170959-44170981 GAGGGGCTGGAGCAGGACACAGG + Intergenic
1179970501 21:44834609-44834631 GGGGCACTGACCTAGGACATAGG + Intergenic
1182228203 22:28816440-28816462 GAGCCACTGCACCAGGCCAGAGG - Intergenic
1183103498 22:35598444-35598466 GAGGGTCTGGACCAGGACAGAGG + Intergenic
1183185333 22:36288566-36288588 GAGTCACTGAACCCCGAGACAGG + Intronic
1183426840 22:37744598-37744620 AGGGCACTGGACCAGGACCCTGG + Intronic
1183829693 22:40411213-40411235 GTGGCACTGAACCAGGAGTAAGG + Exonic
1183956916 22:41386152-41386174 GAGCCACTGCACCTGGCCACAGG - Intronic
1184394086 22:44222365-44222387 GAGGGGCTGAGTCAGGACACTGG - Intergenic
1185058406 22:48592972-48592994 GAGGCCCTGGTCCAGGACTCAGG - Intronic
951523713 3:23632763-23632785 GAGGCCCTGACCCACGCCACTGG - Intergenic
952992404 3:38843153-38843175 GAGGCACTGAGCCAGGAAGGAGG - Intergenic
953055740 3:39385827-39385849 GAGGCACTGAACTTGGACATGGG + Intronic
953120697 3:40038794-40038816 GAGTAAATGAATCAGGACACAGG - Intronic
953584536 3:44187735-44187757 GAGGAACTGATTCAGGAGACAGG + Intergenic
954114827 3:48460727-48460749 AAGGCACTGGGTCAGGACACTGG - Exonic
961601628 3:128066825-128066847 GAGCCCCAGAACCAGCACACAGG + Intronic
962013757 3:131419953-131419975 GAGCCACTGCACCTGGCCACAGG + Intergenic
964102754 3:153006568-153006590 AAAGCACTGAACCAAGAAACAGG + Intergenic
966390590 3:179448948-179448970 CAGTCACTGAAGCAGAACACTGG + Intronic
967615887 3:191565990-191566012 GAGGGCCTGAACTAGAACACGGG - Intergenic
969961829 4:10952299-10952321 GTGACCCTGACCCAGGACACAGG - Intergenic
970435924 4:16035315-16035337 GAGACACTGAACCAAAACCCAGG + Intronic
972249137 4:37280912-37280934 GAGCCACAGCACCAGGCCACAGG - Intronic
973344109 4:49036093-49036115 GAGACCCAGAACCAGGACAAGGG + Intronic
975941510 4:79652893-79652915 AATGTACTGAGCCAGGACACAGG + Intergenic
976216172 4:82717629-82717651 GAGCCACTGCACCAGGCCAAAGG - Intronic
982193701 4:152886126-152886148 GAGTCACTGAATCAGGACAAAGG - Intronic
982296743 4:153836720-153836742 GAGGCAGTGCACCAGGACCATGG - Intergenic
983764286 4:171458092-171458114 GAGCCACTGCACCTGGCCACTGG - Intergenic
986759664 5:10868468-10868490 GAGGCCCTGAGCAAGGACCCAGG - Intergenic
987805926 5:22768390-22768412 CAGGAACTGAGCCAAGACACAGG + Intronic
987965168 5:24863188-24863210 GAGGTACTGACCTAGGACACAGG + Intergenic
990744389 5:58943809-58943831 GAGTCACTGGTTCAGGACACTGG + Intergenic
990873858 5:60462585-60462607 GAGTATCTCAACCAGGACACTGG + Intronic
991310230 5:65231823-65231845 GAGCCACTGCACCTGGCCACAGG - Intronic
991569679 5:68041107-68041129 GAGCCACTGTGCCAGGCCACAGG - Intergenic
993868390 5:93221397-93221419 GAGCCACTGCACCTGGCCACAGG - Intergenic
994099160 5:95875810-95875832 GAGGCAGTGAAGCAGAGCACAGG + Intergenic
994338483 5:98598211-98598233 AAGGCCCTGGACCAGGAGACTGG + Intergenic
994389698 5:99177205-99177227 GAGGCACTGCACCAGATGACAGG - Intergenic
997340945 5:133144192-133144214 GATGGAGTGAACAAGGACACTGG + Intergenic
998877907 5:146618993-146619015 GAGCCCCTGAACCAGGACAAGGG - Intronic
1000209450 5:159096799-159096821 GAGCCAGTGGACCAGGACCCTGG + Intronic
1000625122 5:163529649-163529671 GAGCCACTGAGCCTGGACAGAGG - Intergenic
1000694042 5:164358326-164358348 GGGGCACCGAAGCAGAACACAGG - Intergenic
1001480465 5:172085835-172085857 GCCGCACTGGACTAGGACACAGG - Intronic
1002461070 5:179374112-179374134 GAGGCAGGGAGCCAGGACACAGG + Intergenic
1002701927 5:181130571-181130593 CAGGTACTGAACCCAGACACGGG + Intergenic
1002703870 5:181147575-181147597 TAGGTACTGAACCCAGACACGGG - Intergenic
1003011356 6:2430392-2430414 GAGGCACAGAACCATGCCAGGGG - Intergenic
1003716269 6:8649803-8649825 GAGCCACTGCACCAGGCCAAGGG - Intergenic
1003786776 6:9495322-9495344 GAAGCACTGATCTAGCACACTGG + Intergenic
1006386303 6:33732917-33732939 AAGGCCCAGAACCAGGACTCAGG - Intronic
1006446071 6:34080461-34080483 CAGGCATTGGACCAGGACACTGG - Intronic
1007138685 6:39549086-39549108 GAGTTGCTGAACCAGGACACAGG - Intronic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1007744687 6:44036321-44036343 CAGGAACTGAACCAGGAGCCTGG - Intergenic
1007826186 6:44602607-44602629 AAGGCACTGAAACAGGAAAGAGG + Intergenic
1008761685 6:54859342-54859364 GAGCCACTGCACCCGGCCACGGG + Intronic
1009856234 6:69267891-69267913 GAGCCATTGAAACAGGAAACTGG - Intronic
1012487017 6:99733499-99733521 CAGGGACTGAACCAAGAAACAGG - Intergenic
1013205707 6:107944009-107944031 TAGGCAATAAACCAGGACAGTGG + Intronic
1013315466 6:108937982-108938004 GAGCCACTGCACCCGGCCACAGG + Intronic
1014552938 6:122809991-122810013 CAGGCACTGGACTAGGACCCAGG - Intergenic
1017608782 6:156162330-156162352 GAGCCACTGCACCAGGCCACTGG + Intergenic
1018066984 6:160131344-160131366 CAGGCACTGCCCCAGGAGACAGG + Intronic
1019397918 7:833063-833085 GATCCACTGAACCAAGACATTGG + Intronic
1019990795 7:4689260-4689282 GAGCCACTGCACCCGGCCACCGG + Intronic
1020547397 7:9550137-9550159 AGGGCACTGAACCAGGAAGCAGG - Intergenic
1021225705 7:18023527-18023549 GAGGCACTGTACCTGGCCAAAGG - Intergenic
1021781272 7:24109098-24109120 CAGGCACTGAAACAGGAAAGAGG - Intergenic
1021860803 7:24904165-24904187 GAGTCACTGCACCTGGCCACTGG + Intronic
1023852999 7:44160544-44160566 GAGGCACTGAGACAGGACAAGGG - Intronic
1024923058 7:54581038-54581060 GCAGCACTGAAGCAGGGCACGGG + Intergenic
1026256703 7:68718514-68718536 CAGGCTCTGAACCCAGACACTGG + Intergenic
1026616791 7:71912275-71912297 GAGGAACTGAACAAGGGCTCTGG - Intronic
1027172428 7:75882138-75882160 GAGCCACGGAACCAGGACTGAGG - Exonic
1029642996 7:101832841-101832863 GAGGCACCGGAGCAGGCCACAGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1032017443 7:128389038-128389060 GAGGCAGGGAACCTGGACAGAGG - Intergenic
1032101041 7:128977878-128977900 GAGGCACTGCACCTGGCCAGGGG + Intronic
1032379215 7:131458607-131458629 GTGGCACTGATACATGACACAGG - Intronic
1033036706 7:137882302-137882324 GAGGGACTGAACCAGGCCTATGG + Intronic
1033059869 7:138095914-138095936 GAGCCACTGCACCAGGCCTCAGG - Intronic
1034877942 7:154741876-154741898 GAGACACAGATGCAGGACACTGG - Intronic
1036209622 8:6831729-6831751 GAGCCACTGCACCTGGCCACAGG - Intronic
1036616104 8:10388955-10388977 GAATCACTGAACTAGGGCACTGG + Intronic
1036723389 8:11199721-11199743 GAGGGACTGAACTGGGACACGGG + Intronic
1037303080 8:17473436-17473458 CATGGACTGAACCAGGTCACCGG - Intergenic
1039047770 8:33465758-33465780 GAGCCACTGCACCCGGCCACAGG + Intronic
1040639530 8:49317100-49317122 AAGCCAATGAACCAAGACACTGG + Intergenic
1040879864 8:52192926-52192948 GAGTCACTGACCCTGGTCACTGG + Intronic
1046101674 8:109621604-109621626 CTGGCACTGAACCAGCCCACAGG + Intronic
1048549764 8:135423629-135423651 GAGACACTGAAAGAGCACACAGG - Intergenic
1048589613 8:135809249-135809271 CAGCCAGTGAACCAGGATACAGG + Intergenic
1048775098 8:137936758-137936780 GAGGCAATGAAATAGGACACTGG + Intergenic
1048926306 8:139275584-139275606 GCAGCACTGTACCAGGATACTGG + Intergenic
1049597799 8:143492709-143492731 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597812 8:143492744-143492766 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597826 8:143492779-143492801 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597840 8:143492814-143492836 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597854 8:143492849-143492871 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597867 8:143492884-143492906 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597880 8:143492919-143492941 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597893 8:143492954-143492976 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597906 8:143492989-143493011 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597919 8:143493024-143493046 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597933 8:143493059-143493081 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597944 8:143493094-143493116 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597957 8:143493129-143493151 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597971 8:143493164-143493186 GAGCCCCTGGGCCAGGACACGGG - Intronic
1049597985 8:143493199-143493221 GAGCCCCTGGGCCAGGACACGGG - Intronic
1050195105 9:3074686-3074708 GAGGGCCTGAACCAGGGCAGTGG - Intergenic
1050411748 9:5373456-5373478 GGGGCTCTGAACCAAGACCCTGG + Intronic
1051005893 9:12343839-12343861 GAGGCTCAGAAATAGGACACTGG + Intergenic
1052472232 9:28914730-28914752 GAGGGATTGTTCCAGGACACTGG - Intergenic
1054852052 9:69857308-69857330 GAGGCACTGTGCCAGGATGCAGG - Intronic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1059395274 9:114030508-114030530 GAGACACTGAAGCTGGAGACCGG - Intronic
1059723466 9:116984202-116984224 GAGGGCCTGAACCAGGCCAGTGG - Intronic
1060310368 9:122454231-122454253 GAGCCACTGCACCCGGCCACTGG - Intergenic
1060411269 9:123401968-123401990 TAGACACTGTACCAGGATACAGG - Intronic
1060482014 9:124022078-124022100 GAGGCACAGAAGCAGGTCCCAGG + Intronic
1062495584 9:136830089-136830111 GGGGCCCTGCACCAGGACACTGG - Intronic
1187822100 X:23298624-23298646 CAGCCACTGAGCCAGGACAGGGG - Intergenic
1192330707 X:70173153-70173175 AAGACCCTGAACCAGGACACTGG + Intergenic
1193712558 X:84896016-84896038 GAGGCACTGACCCATGAGTCAGG + Intergenic
1197530822 X:127623664-127623686 AAGACCCTCAACCAGGACACAGG + Intergenic
1200168073 X:154050972-154050994 GAGGGATTGAACCAGGACAGCGG + Intronic
1200839721 Y:7768642-7768664 GAAGCAATGAACAAGGACTCTGG + Intergenic
1201067877 Y:10116643-10116665 GAGGAACTCAAGCAGGACATGGG + Intergenic
1201075102 Y:10180922-10180944 GAGCCACTGCACCTGGACTCTGG + Intergenic