ID: 1123022636

View in Genome Browser
Species Human (GRCh38)
Location 14:105408811-105408833
Sequence CTGAGTAGACAGAATGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123022636_1123022641 19 Left 1123022636 14:105408811-105408833 CCACCAGCATTCTGTCTACTCAG 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1123022641 14:105408853-105408875 TTAGCTTTACAGTGACCATGTGG 0: 1
1: 0
2: 1
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123022636 Original CRISPR CTGAGTAGACAGAATGCTGG TGG (reversed) Intronic
903503709 1:23817488-23817510 CTTAGGAGACACAAAGCTGGTGG + Exonic
905544419 1:38786371-38786393 CTGAGTTGAAGGAATTCTGGAGG + Intergenic
906910921 1:49949410-49949432 CAGAGTAAACAGAATGCTGTGGG + Intronic
906929972 1:50159722-50159744 GAGAGTATACAAAATGCTGGAGG - Intronic
907273870 1:53306260-53306282 CTAGGTATGCAGAATGCTGGAGG - Intronic
907634731 1:56122630-56122652 CTGAGCAAAAAGAAAGCTGGAGG - Intergenic
909901194 1:81137799-81137821 CTAAGTAGACAGACAGCAGGTGG + Intergenic
911380342 1:97106408-97106430 CTGAGTAAAGAGAATGTGGGCGG + Intronic
913543273 1:119842132-119842154 TTGAGTATACTGAATGCTGCTGG + Intergenic
913990687 1:143609034-143609056 TTGAGTATACTGAATGCTGCTGG + Intergenic
914381528 1:147120775-147120797 TTGAGTATACTGAATGCTGCTGG + Intergenic
914921804 1:151852479-151852501 ATGACTAGACAGCATCCTGGAGG + Intronic
914940712 1:152020619-152020641 TTGAGTATACTGAATGCTGCTGG - Intergenic
915117059 1:153607842-153607864 CTGAGAAGACAGAGGCCTGGGGG + Intronic
915526559 1:156479793-156479815 TTGACTAGACAGAAAGATGGAGG + Exonic
919737845 1:200964639-200964661 CTGCTTAAACAGAATGCTGTAGG + Intergenic
920548064 1:206835253-206835275 CTGAGGAGACAGAGCTCTGGGGG + Intronic
922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG + Intronic
923079994 1:230644085-230644107 CTGAGTTGACAGAATGCCTTTGG + Intronic
923102282 1:230826221-230826243 CTGAGTAGAACGAGAGCTGGAGG + Intergenic
924751745 1:246899197-246899219 CTGAGGAGACAGAAAGCTTGAGG + Intronic
1063689957 10:8277578-8277600 CTGAGTAGATAAAATGTTTGGGG + Intergenic
1065782170 10:29180011-29180033 CTCTGTGGAAAGAATGCTGGGGG + Intergenic
1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG + Intronic
1066662454 10:37749706-37749728 CTGAGAACACAGCATGCTGCTGG - Intergenic
1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG + Intronic
1069903770 10:71720457-71720479 CTGGGGAGAAAGAAGGCTGGGGG - Intronic
1071449071 10:85777321-85777343 TTGAGTGGACAGTAGGCTGGAGG - Intronic
1071874690 10:89832397-89832419 CTGAGTAGGCATAGTGCTTGAGG - Intergenic
1074183916 10:111085266-111085288 CTGACTACAGAGAATTCTGGAGG + Intergenic
1074407138 10:113189209-113189231 ATGTGTAGGCAGAATGCTGTGGG - Intergenic
1075529230 10:123213440-123213462 TTGAGCAGACAGAATGCTGGGGG + Intergenic
1075892104 10:125960940-125960962 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1076414012 10:130271967-130271989 CTGAATGGAAAGAATGCTGTCGG - Intergenic
1076479762 10:130777486-130777508 CTGTGTAGACAGAAAGCTTAGGG - Intergenic
1077051143 11:567632-567654 CTCAGCAGACAGGCTGCTGGAGG + Intergenic
1077357414 11:2124962-2124984 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077357504 11:2125424-2125446 ATGAGTAGACAGATGACTGGGGG + Intergenic
1077357521 11:2125513-2125535 ATGAGTAGACAGATGACTGGGGG + Intergenic
1079428910 11:20369850-20369872 CTGAGTAGACTGAATTTTGTGGG - Intronic
1079924452 11:26476532-26476554 GTGAGCAGACACAATGCTGCAGG + Intronic
1081708317 11:45199743-45199765 CTGAGTAGAGAGCAGGCTGTGGG - Intronic
1081746231 11:45474276-45474298 CTGGGTAGGCAGGAGGCTGGTGG - Intergenic
1083283283 11:61640855-61640877 CTGAGTAGACCTAGGGCTGGGGG - Intergenic
1084482939 11:69432536-69432558 CTGAGAAGCCAGAATGTGGGTGG + Intergenic
1084495248 11:69499666-69499688 CTGAGTAGACAGAGTGAAAGGGG - Intergenic
1085674797 11:78506482-78506504 GTGGGTAGACAGATTCCTGGTGG - Intronic
1085814528 11:79723133-79723155 CTGAGCAAAAAGAATGCTGGAGG + Intergenic
1087571185 11:99929245-99929267 CTCAGAAGACAGAAAGATGGGGG - Intronic
1090063096 11:123480495-123480517 GTGGGTAGAGAGAATGCTGGAGG + Intergenic
1090664125 11:128903758-128903780 ATGAGTAGGGAGCATGCTGGAGG + Intronic
1090830072 11:130415068-130415090 CTGGGTACACAGAATGTCGGGGG - Intronic
1091639376 12:2223404-2223426 CTGGTTGGAAAGAATGCTGGTGG + Intronic
1092045381 12:5428816-5428838 CTCAGTGGACTGAATGCTGGTGG - Intergenic
1092254702 12:6920142-6920164 GTGAGTAGAAAGAAGGCTGAGGG + Intronic
1094325123 12:29229810-29229832 CAGATTAGACAGAATACTGAAGG + Intronic
1095694715 12:45131662-45131684 CTGAGTAGAAACAGTGCAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096872204 12:54600248-54600270 CTGAGAAGTCAGAGTGTTGGGGG + Intergenic
1101905686 12:108823898-108823920 CTAAGCAGGCAGATTGCTGGAGG - Intronic
1102180834 12:110911253-110911275 CTGAGTGGACGGATAGCTGGGGG + Intronic
1102635871 12:114323384-114323406 TGGAGGAGAAAGAATGCTGGAGG - Intergenic
1103846885 12:123908041-123908063 CTGAGCAGACAGCAACCTGGAGG - Intronic
1106430548 13:29676510-29676532 CTGAGTAGACAGCTTGCATGAGG - Intergenic
1111385376 13:87520726-87520748 CTGAGAAGACAGAAAGATGTGGG + Intergenic
1111637807 13:90928373-90928395 CTGAGCAGTAAGATTGCTGGGGG - Intergenic
1114544266 14:23487007-23487029 CTGAGCAAACAGCATGCTGTGGG + Intronic
1116044830 14:39731995-39732017 CCGAGTAGCCAGGATGCTGTAGG + Intergenic
1117316696 14:54577766-54577788 CAGAGAAGACAGAATGGCGGGGG + Intronic
1117726855 14:58683134-58683156 CTGTGTAGATAGTATGTTGGAGG + Intergenic
1121097599 14:91228690-91228712 CTGAGTTCTCAGGATGCTGGAGG - Intergenic
1122499662 14:102188372-102188394 CTGAGTGGACAGAAATGTGGAGG - Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1124583794 15:30986830-30986852 CTGGATAGCGAGAATGCTGGAGG - Intronic
1131886074 15:96914469-96914491 GTGAGGAGAGAGAATGCTAGTGG - Intergenic
1133604465 16:7372618-7372640 CTAAGTGCACAGAATGGTGGAGG + Intronic
1137247746 16:46719376-46719398 CGGAGGAAACAGAATCCTGGAGG + Intronic
1137372873 16:47924996-47925018 CATAGTAGACAGAAGGCTGAAGG - Intergenic
1137707413 16:50545213-50545235 CCAGGTAGACAGCATGCTGGTGG + Intergenic
1137840529 16:51636776-51636798 CTGAGTAGTTGGAGTGCTGGTGG + Intergenic
1138348029 16:56331807-56331829 CTGAGTAGGCAGAAGTCAGGAGG - Intronic
1139611613 16:68063033-68063055 CTGAGAAGAGAGGAGGCTGGAGG - Intronic
1139614990 16:68083589-68083611 ATGAGTGGGCAGAATGCTGCAGG - Intergenic
1140274208 16:73494301-73494323 ATTAGCAGAGAGAATGCTGGAGG - Intergenic
1140546966 16:75819996-75820018 CTGATTAAACTGAATGCTGATGG + Intergenic
1141465427 16:84202829-84202851 CAGAGTAGACAGATTTGTGGTGG + Intergenic
1141714888 16:85721158-85721180 ATGAGTAGATTGAAGGCTGGAGG - Intronic
1143470813 17:7174068-7174090 CTGAGGAGAGAGAAGGCGGGTGG + Intronic
1144655113 17:17030167-17030189 GGGAGTGGACAGAAGGCTGGGGG - Intergenic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1145288506 17:21523832-21523854 CTAAGCATCCAGAATGCTGGAGG - Intergenic
1147465527 17:40607843-40607865 CTGAGTAGAGAGGATGCGGTGGG - Intergenic
1151156429 17:72126760-72126782 GTCAGTAGACAGAATGCCAGAGG + Intergenic
1151161840 17:72172527-72172549 CTGAGTGGAGAGGATGCTTGGGG + Intergenic
1151862075 17:76771797-76771819 CTGGGCAGAGAGAATGCTGTAGG + Intronic
1152650655 17:81491088-81491110 CGGAGTAGACAGAATTCTCGTGG - Intergenic
1152988267 18:339119-339141 CTGCTCAGACAGACTGCTGGTGG + Intronic
1154953458 18:21232067-21232089 TTGAGTGGACAGATTGCTTGAGG + Intergenic
1155781429 18:29841502-29841524 CAGAGTAGAGAGAATTTTGGGGG - Intergenic
1156434268 18:37109716-37109738 GTGAATAGACAGAGTACTGGTGG + Intronic
1157448224 18:47764332-47764354 CAGAGAAAACAGAATGCTGTTGG + Intergenic
1162470171 19:10868349-10868371 CTCAGTTGACAGCAGGCTGGGGG - Intronic
1162549676 19:11351542-11351564 CAGGGAAGACAGAAAGCTGGAGG + Intronic
1163133745 19:15294057-15294079 ATGAGTAGACTGAGGGCTGGGGG + Intronic
1163566105 19:18052204-18052226 CTGAGTGGACAGAACCTTGGCGG - Intergenic
1165959389 19:39521695-39521717 CTGCTAAGACAGAGTGCTGGAGG + Intergenic
1166760961 19:45224382-45224404 CTGAGGAGAGAGACTGCAGGGGG - Intronic
1167374851 19:49105244-49105266 ATGAGGAGACCGAATGCAGGAGG - Intronic
1168497003 19:56861705-56861727 TTGAGTAGACTAAGTGCTGGAGG - Intergenic
1202678263 1_KI270711v1_random:27039-27061 TTGAGTATACTGAATGCTGCTGG + Intergenic
925852028 2:8091137-8091159 CTGTGTAGCCAGAATGAGGGAGG - Intergenic
927112025 2:19870267-19870289 GTTAGTAGACAGACGGCTGGAGG - Intergenic
928815702 2:35292462-35292484 CTGGTTAGACAGAGTGCTGCAGG + Intergenic
932261359 2:70330431-70330453 CTGAGCTCACAGAGTGCTGGAGG - Intergenic
932329990 2:70893046-70893068 TTGAGGAGATAGAAGGCTGGGGG + Intergenic
933891839 2:86778989-86779011 CTGAGGAGCCCAAATGCTGGAGG - Intergenic
934116993 2:88807953-88807975 CTGAGAAGACAGAATGCCCCGGG + Intergenic
935659481 2:105453769-105453791 GAGATTAGACAGAATCCTGGAGG - Intergenic
936160494 2:110080878-110080900 CTGAGAAGACAGAATGCACCGGG + Intergenic
936184170 2:110290476-110290498 CTGAGAAGACAGAATGCACCGGG - Intergenic
936251125 2:110869221-110869243 CTGAGTATTCACAATGCCGGTGG - Intronic
936286311 2:111184127-111184149 TTCAGCAGACAGAATTCTGGAGG + Intergenic
936663683 2:114570486-114570508 CACAGTAGGCAGAATGATGGGGG + Intronic
936665451 2:114589551-114589573 GTGAGTAGAAAGCATGCTTGAGG + Intronic
938247998 2:129793843-129793865 CTGAGTGTAAAGAAGGCTGGGGG - Intergenic
940130654 2:150377841-150377863 CTGTGTAGAGATAATGCTGAAGG - Intergenic
941152863 2:161937333-161937355 CTGTGCAGACTGAGTGCTGGGGG - Intronic
941945914 2:171097030-171097052 CTGAGTAAGCACAAAGCTGGAGG + Intronic
943142244 2:183997527-183997549 CTGTGTTGAGAAAATGCTGGGGG - Intergenic
943552865 2:189362416-189362438 CTGGGCTGACAGAATGCTGCTGG - Intergenic
945954968 2:216078136-216078158 CTGACTAGAAAGAAAACTGGAGG + Intronic
948003668 2:234590001-234590023 TTGAGGAGAGAGAATGTTGGTGG + Intergenic
948471307 2:238182074-238182096 ATGAGGATACAGAAGGCTGGAGG - Exonic
1170075572 20:12415280-12415302 CTGCAGACACAGAATGCTGGAGG - Intergenic
1172962384 20:38807667-38807689 CTGAGTCCCCAGGATGCTGGGGG + Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1177026872 21:15931763-15931785 CTCTGTAGACACCATGCTGGAGG + Intergenic
1177410695 21:20727085-20727107 GTGAGTAAACACAGTGCTGGAGG - Intergenic
1177473486 21:21588968-21588990 CTCAGTAGAAACAATGCCGGTGG + Intergenic
1178384391 21:32137688-32137710 CTGAGAAGGCAGAGTGCAGGTGG + Intergenic
1179560649 21:42214049-42214071 GTGAGAAGACTGAATTCTGGAGG + Intronic
1180101081 21:45586310-45586332 CTGAAAAGTCAGAAAGCTGGCGG + Intergenic
1182415959 22:30221588-30221610 CCGAGGAGACAGGAAGCTGGTGG - Intergenic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
949100593 3:139854-139876 CTAAGTAGACAGAAAGCTCAGGG + Intergenic
949670229 3:6391472-6391494 CTGGGTAGAAGGAATGCTGATGG + Intergenic
950521529 3:13500612-13500634 CTGAGCAGGGAGGATGCTGGGGG + Intronic
952674648 3:36013036-36013058 CTGAGTAGAAAAAATGCAGAAGG - Intergenic
953670558 3:44958766-44958788 CAGAGCAGAAAGCATGCTGGAGG - Intronic
954425867 3:50442863-50442885 CTGAGTAGACAAAGGCCTGGAGG - Intronic
954760662 3:52871306-52871328 CTGGGCAGAGAGGATGCTGGGGG + Intronic
962447131 3:135476399-135476421 CTGAGTTGACTGATGGCTGGGGG + Intergenic
966504361 3:180683005-180683027 CTGAGTAGGAAGCATGCTGATGG - Intronic
970477596 4:16439453-16439475 CTGGGAAGACAGAAAGCAGGAGG - Intergenic
972541044 4:40039655-40039677 CTGAGGTGAGAGAATCCTGGAGG + Intergenic
976256651 4:83107278-83107300 CTGAGAATAAAGAATTCTGGAGG - Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
978454590 4:108874373-108874395 CTGAGTAGACAAAGTGACGGAGG + Intronic
980186314 4:129465305-129465327 CTGATTATACATAATGCTGGTGG + Intergenic
982955524 4:161760959-161760981 CTGACTAGAGAGGGTGCTGGAGG - Intronic
991995376 5:72381267-72381289 CTAAGTATAAAGAATGTTGGGGG + Intergenic
993280739 5:85921424-85921446 ATGAGTAGATGGAATGGTGGAGG - Intergenic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
994263299 5:97685094-97685116 CTGGGTAGATACAATGGTGGAGG + Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
1000675057 5:164111571-164111593 ATGAGTAGAAAGAACGCTGCTGG + Intergenic
1006566032 6:34958243-34958265 GTGAGTAGTGAGAATTCTGGGGG - Intronic
1007086782 6:39153733-39153755 CTGAAGAGAGAGCATGCTGGTGG - Intergenic
1012804877 6:103881280-103881302 CTGAATTGACAGAAAACTGGAGG + Intergenic
1014703800 6:124722022-124722044 CTGAGTAGTCAAAATCATGGAGG - Intronic
1014889437 6:126824799-126824821 CTGGGTAGAGATTATGCTGGTGG - Intergenic
1015361991 6:132350649-132350671 CTGTGAAGAAAGAATGATGGTGG + Intronic
1016395159 6:143616680-143616702 ATGAATAGACAAAATGCTTGGGG + Intronic
1019646091 7:2129797-2129819 GTGTGTAGACAGGATCCTGGGGG - Intronic
1022746523 7:33178381-33178403 CTGAGTGGACACAATGAAGGTGG - Intronic
1023215765 7:37861084-37861106 CTGTGTGGAAAAAATGCTGGGGG - Intronic
1023937806 7:44751609-44751631 CTGCGGAGACAGAAGGCTGGTGG + Intronic
1024012619 7:45282883-45282905 CTGAGGAGACAGGATGCTGATGG - Intergenic
1024247695 7:47482595-47482617 CTGAGTAGATACCATGCTTGAGG - Intronic
1024710272 7:52007724-52007746 TTGACTAGAGAGAATTCTGGAGG + Intergenic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1032457263 7:132082895-132082917 CTGAGTAGAGAACATGCAGGAGG - Intergenic
1032936407 7:136737761-136737783 CTAAGTAGAAACAATGCAGGAGG - Intergenic
1033035313 7:137870651-137870673 CTGAGTAGAAACAATGCTATTGG - Intergenic
1033849082 7:145472466-145472488 CTGAGTAGACAGAAGACTGTGGG - Intergenic
1034436157 7:151063597-151063619 CTGAGGGGGCAGACTGCTGGGGG + Intronic
1035375238 7:158403158-158403180 TTGAGCAGACAGAATGCACGTGG + Intronic
1035438419 7:158876815-158876837 CTGACTATACACAGTGCTGGAGG - Intronic
1036514338 8:9429910-9429932 CTGAGTAGACAGAATTACAGGGG + Intergenic
1038016360 8:23519098-23519120 CTGAGTAGGCAGATTTCTTGGGG + Intergenic
1043567130 8:81560943-81560965 CTGAGGAGCCACAATGCTGCGGG + Intergenic
1045101380 8:98847984-98848006 CTGAATAAACAGCATGCTGAAGG - Intronic
1047136331 8:122082802-122082824 CTGAGTACACAGTAGGCAGGGGG - Intergenic
1047176609 8:122547160-122547182 CTGACTAACAAGAATGCTGGGGG + Intergenic
1047790913 8:128202875-128202897 CTGAGAGGACAGAATGCTTGGGG - Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049713715 8:144079516-144079538 CAGAGCAGAAAGACTGCTGGTGG + Intronic
1057855124 9:98595757-98595779 CTGGATAGACAGGAGGCTGGAGG + Intronic
1057908032 9:98997466-98997488 CTGAGTAGGCGGTATGCTGTCGG - Intronic
1060149601 9:121279793-121279815 CAGAGTTGACAGAGTGCGGGAGG + Intronic
1060225270 9:121786508-121786530 CTGAGAAGCCAGGGTGCTGGAGG - Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1186658506 X:11643074-11643096 TTGAGTAGACAGCTTGGTGGTGG - Intronic
1186663087 X:11689026-11689048 CTGAGTAGGCTGAAAACTGGAGG - Intergenic
1194242966 X:91474370-91474392 CTGTGTAGAAAGAATGATGCTGG + Intergenic
1195083492 X:101392280-101392302 CTGAGAATACAGAATTCAGGAGG - Intronic
1196692870 X:118579543-118579565 CTAGGGATACAGAATGCTGGAGG - Intronic
1197261021 X:124318184-124318206 CTGAGCAAAAAGAAAGCTGGAGG + Intronic
1200133462 X:153863626-153863648 CTGTTGAGACAGAGTGCTGGGGG - Intronic