ID: 1123023987

View in Genome Browser
Species Human (GRCh38)
Location 14:105415054-105415076
Sequence AGCGCCACGGGCGGCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123023979_1123023987 -8 Left 1123023979 14:105415039-105415061 CCCGCAGGCCTCCGCAGCGCCAC 0: 1
1: 0
2: 0
3: 23
4: 226
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023972_1123023987 11 Left 1123023972 14:105415020-105415042 CCGCCACTGCGCCTCCCCACCCG 0: 1
1: 0
2: 5
3: 42
4: 509
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023975_1123023987 0 Left 1123023975 14:105415031-105415053 CCTCCCCACCCGCAGGCCTCCGC 0: 1
1: 0
2: 3
3: 54
4: 616
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023969_1123023987 17 Left 1123023969 14:105415014-105415036 CCCCGGCCGCCACTGCGCCTCCC 0: 1
1: 0
2: 2
3: 68
4: 460
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023970_1123023987 16 Left 1123023970 14:105415015-105415037 CCCGGCCGCCACTGCGCCTCCCC 0: 1
1: 0
2: 2
3: 41
4: 461
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023980_1123023987 -9 Left 1123023980 14:105415040-105415062 CCGCAGGCCTCCGCAGCGCCACG 0: 1
1: 0
2: 2
3: 16
4: 212
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023977_1123023987 -4 Left 1123023977 14:105415035-105415057 CCCACCCGCAGGCCTCCGCAGCG 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023968_1123023987 23 Left 1123023968 14:105415008-105415030 CCGTCGCCCCGGCCGCCACTGCG 0: 1
1: 0
2: 2
3: 15
4: 506
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023973_1123023987 8 Left 1123023973 14:105415023-105415045 CCACTGCGCCTCCCCACCCGCAG 0: 1
1: 0
2: 5
3: 52
4: 581
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023971_1123023987 15 Left 1123023971 14:105415016-105415038 CCGGCCGCCACTGCGCCTCCCCA 0: 1
1: 0
2: 2
3: 45
4: 404
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023978_1123023987 -5 Left 1123023978 14:105415036-105415058 CCACCCGCAGGCCTCCGCAGCGC 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1123023976_1123023987 -3 Left 1123023976 14:105415034-105415056 CCCCACCCGCAGGCCTCCGCAGC 0: 1
1: 0
2: 0
3: 31
4: 313
Right 1123023987 14:105415054-105415076 AGCGCCACGGGCGGCCGCGCGGG 0: 1
1: 0
2: 0
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123023987 Original CRISPR AGCGCCACGGGCGGCCGCGC GGG Intronic