ID: 1123024650

View in Genome Browser
Species Human (GRCh38)
Location 14:105419139-105419161
Sequence GCCTCACTGCGGAAAGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123024647_1123024650 7 Left 1123024647 14:105419109-105419131 CCTGACAGGTGGTGGGAAGAGAA 0: 1
1: 0
2: 2
3: 21
4: 321
Right 1123024650 14:105419139-105419161 GCCTCACTGCGGAAAGAGCACGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123024650 Original CRISPR GCCTCACTGCGGAAAGAGCA CGG Intronic
900694776 1:4002893-4002915 GCCTGACTGCGGATGGAGGAAGG + Intergenic
901021344 1:6257511-6257533 GCCTCCCCGCGGAAGAAGCATGG - Intronic
901191247 1:7411246-7411268 GCCTCCCTGGGGCATGAGCAGGG + Intronic
903564482 1:24254507-24254529 GCGTCCTTGCGGAAAGAGGAAGG - Intergenic
903744134 1:25575241-25575263 CCAGCACTGTGGAAAGAGCATGG + Intergenic
904784098 1:32972874-32972896 TTCACACTGCGGAACGAGCACGG + Intergenic
905860994 1:41351288-41351310 GCCTGACAGAGGAATGAGCAAGG + Intergenic
907711915 1:56891252-56891274 CCCTGTCTGAGGAAAGAGCATGG + Intronic
908005462 1:59723194-59723216 CCCTCCCAGCTGAAAGAGCAAGG + Intronic
908515745 1:64891289-64891311 TCCCCACTGTGGAACGAGCAGGG - Intronic
912498923 1:110108960-110108982 GCCTCTCTGCAGAGGGAGCAGGG - Intergenic
915244067 1:154543946-154543968 GACCCTCTGCGGGAAGAGCAAGG - Exonic
916862805 1:168824389-168824411 CCCTGACTGCAGATAGAGCAAGG - Intergenic
917516009 1:175709046-175709068 GCCTCACTGGGGGAAGATGAAGG + Intronic
919178045 1:194044931-194044953 ACCTCACTGAGGAAAGACTAAGG - Intergenic
919757888 1:201077244-201077266 GCCTCACTGCTGGAAGACCCTGG + Intronic
924456127 1:244220042-244220064 CTCTCCCTGCGGACAGAGCATGG - Intergenic
1063873366 10:10444504-10444526 GCCTCATTTCGAAAAGGGCAGGG + Intergenic
1065723199 10:28645516-28645538 GCCTCAGAGCGGAAGGAGAAAGG - Intergenic
1067777276 10:49172703-49172725 GCCTCATTGCACACAGAGCATGG + Intronic
1070724515 10:78779007-78779029 GACTCAATGGGGAAAGTGCAAGG - Intergenic
1071625939 10:87169988-87170010 GCCTCGCTGTGGAAAGAGTAAGG + Intronic
1072923396 10:99595683-99595705 GCCACACAGAGGAAATAGCAAGG - Intergenic
1074418416 10:113287179-113287201 CCAGCACTGCGGAAAGATCATGG + Intergenic
1076682395 10:132179901-132179923 ACCTCACAGGGGGAAGAGCATGG - Intronic
1077540351 11:3143721-3143743 GGCTCTTTGGGGAAAGAGCATGG + Intronic
1085455854 11:76665026-76665048 GCCTGGCTGGGGAAAGGGCAGGG - Intronic
1087541135 11:99521658-99521680 GACTCACTGCTTAATGAGCAAGG - Intronic
1087836765 11:102882835-102882857 TCCACACTGTGGAGAGAGCAAGG + Intergenic
1088720434 11:112587460-112587482 GCCTCACTGGGCAAAGGGGATGG + Intergenic
1090609341 11:128456306-128456328 GCCTCACTGCAAAAAGTGCCAGG + Intergenic
1091243082 11:134067630-134067652 GTCTGACTGTGGACAGAGCACGG - Intergenic
1091291318 11:134441464-134441486 GCCGCACTGCGGGAAAAGCAGGG - Intergenic
1091699776 12:2651864-2651886 GCCACACAGAGGAAGGAGCAGGG - Intronic
1095921878 12:47540092-47540114 GGCTCTTTGCTGAAAGAGCAAGG - Intergenic
1098514162 12:71354389-71354411 GCCACAGTGCAGAAAGGGCAGGG + Intronic
1100508925 12:95249361-95249383 CCCCCACTGGGGCAAGAGCAGGG + Intronic
1107029393 13:35835198-35835220 GCCCCACTGCGGGCAGAGAAAGG + Intronic
1110345106 13:74438004-74438026 GCATCACTGCGGTAAAAGAAAGG + Intergenic
1110829033 13:80009179-80009201 GAGTCACTGTGGAAAGAGTAGGG + Intergenic
1116050221 14:39793688-39793710 GACTCACTGGGGAAAAAGTAAGG + Intergenic
1116211268 14:41947912-41947934 GCCTAACAGCAGAAAGAGTAGGG - Intergenic
1121700197 14:95947073-95947095 GACTCACTGAGCACAGAGCAAGG - Intergenic
1121837423 14:97104533-97104555 GACCCACTGGGAAAAGAGCAAGG - Intergenic
1122420544 14:101573799-101573821 GTCACACTGTGGAAAGAGCATGG + Intergenic
1122954987 14:105066354-105066376 TCCCCACTGCTGAAAGAGCCTGG - Intergenic
1123024650 14:105419139-105419161 GCCTCACTGCGGAAAGAGCACGG + Intronic
1123855555 15:24407238-24407260 GCATCACTGGGGAAAGAGTCAGG + Intergenic
1123864086 15:24499428-24499450 GCATCACTGGGGAAAGAGTCAGG + Intergenic
1124295219 15:28496146-28496168 ACCTCAGTGGGGAAGGAGCAAGG - Intergenic
1130285960 15:82554706-82554728 GCCTCTTTGCTGAAAGAGGAGGG - Intronic
1132238877 15:100242230-100242252 GACTCACGGTGTAAAGAGCAAGG - Intronic
1132709421 16:1259813-1259835 GCCCCACTCTGGAAAGACCAGGG + Intergenic
1133095054 16:3438705-3438727 TCCTCACTGAGGAAAGATCAAGG + Intronic
1133867265 16:9655812-9655834 ACCTTCCTGAGGAAAGAGCAGGG - Intergenic
1137624774 16:49900683-49900705 GCCACACAGCAGAAGGAGCAGGG - Intergenic
1138196908 16:55058729-55058751 GCCTCCCTGGGCACAGAGCAAGG - Intergenic
1142848790 17:2694559-2694581 GTCTCACTGAGGAGGGAGCAGGG + Exonic
1147726555 17:42569187-42569209 GCCTCTCTGTGGAAACAGCAGGG - Exonic
1149561136 17:57608701-57608723 GCCTCACAGCAGAACGAACAGGG - Intronic
1152531557 17:80922213-80922235 GCCCGGCTCCGGAAAGAGCATGG + Intronic
1152945818 17:83196854-83196876 GCCTCACTGTGGAAGGTGCAGGG + Intergenic
1153835039 18:8956073-8956095 GTGTCACTAGGGAAAGAGCATGG - Intergenic
1155224968 18:23721429-23721451 GCCCGAATGAGGAAAGAGCATGG + Intronic
1158466364 18:57693750-57693772 GCCTAACTGTGCAAACAGCATGG + Intronic
1159204890 18:65236620-65236642 GCTAAACTGCAGAAAGAGCATGG + Intergenic
1160959500 19:1713045-1713067 GCCTCCCTGGGCACAGAGCAGGG + Intergenic
1167296273 19:48652014-48652036 GCCTCACTGCACACAGAGCCTGG + Intergenic
1167942995 19:52962646-52962668 GCCCCACTGCAGAAAGACCGGGG + Intronic
925323548 2:2997292-2997314 GGCTTACTGGGCAAAGAGCACGG + Intergenic
927863255 2:26573587-26573609 GCCTCACAGGAGAGAGAGCAAGG + Intronic
927975282 2:27333899-27333921 GACTCACTGTGGAATCAGCAAGG + Intronic
927975818 2:27337337-27337359 GCCTCACTGGGGGAAGACAAAGG + Exonic
928752543 2:34487615-34487637 TCCCCACTGCAGAAAGAGGAAGG + Intergenic
931770030 2:65489391-65489413 CCCTCAGTGCTGAAAGAGCTTGG - Intergenic
932422099 2:71607260-71607282 GCCTCAAAGCTAAAAGAGCATGG + Intronic
934044471 2:88161041-88161063 GCCTGAGTGCAGAAGGAGCAGGG - Intergenic
938067856 2:128291739-128291761 GCCTCCCCGTGGAAAGAGGAGGG - Intronic
938312884 2:130305287-130305309 AGCTCACTGAAGAAAGAGCATGG + Intergenic
938611569 2:132952934-132952956 GCTTCACTGTGGAAAGTGAAGGG + Intronic
942706741 2:178782367-178782389 GCCTCACAGAGGAACAAGCAGGG - Exonic
947290463 2:228568448-228568470 GCCTCACTTTGGGAAGCGCAAGG + Intergenic
1169111857 20:3039350-3039372 TCCACCCTGAGGAAAGAGCATGG + Intergenic
1169312780 20:4561025-4561047 GCCTCCCAGAGCAAAGAGCAAGG + Intergenic
1169900694 20:10549263-10549285 GCCTCACTGTAGAAAGAACGAGG - Intronic
1170186826 20:13600831-13600853 GCCTCTCAGCTGACAGAGCAAGG - Intronic
1170306945 20:14948653-14948675 GCCTCCCTGGGCCAAGAGCAGGG + Intronic
1170454521 20:16519894-16519916 GCCTCACCCCGGGAAGTGCAAGG + Intronic
1170676789 20:18489492-18489514 GACTCACTTCGGATAGAGAAGGG + Exonic
1172404719 20:34679406-34679428 GACTGAGTGGGGAAAGAGCAAGG + Intergenic
1175212547 20:57370124-57370146 GCCCCACTGCGGAAGGAATAGGG - Intronic
1176122171 20:63458839-63458861 TCCGCACAGCGGGAAGAGCAAGG + Intronic
1176336400 21:5603474-5603496 GCCTCACTGGAGGAAGAGAAAGG + Intergenic
1176391357 21:6217474-6217496 GCCTCACTGGAGGAAGAGAAAGG - Intergenic
1176470062 21:7098700-7098722 GCCTCACTGGAGGAAGAGAAAGG + Intergenic
1176493623 21:7480478-7480500 GCCTCACTGGAGGAAGAGAAAGG + Intergenic
1176507019 21:7657905-7657927 GCCTCACTGGAGGAAGAGAAAGG - Intergenic
1179452734 21:41476615-41476637 GCATCACTGCAAAAAGAACAGGG + Exonic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181523805 22:23466679-23466701 GGCTCCCTGGGGAAGGAGCAGGG - Intergenic
1183417451 22:37690779-37690801 GACTCACCGCTGAGAGAGCAGGG - Exonic
1184426497 22:44412006-44412028 GCTTCAGTGCAGAAAGAGCCTGG + Intergenic
1184856853 22:47150995-47151017 GCATCACAGCAGGAAGAGCAAGG - Intronic
949245294 3:1919450-1919472 GCCTCACCTGGGAAAGTGCAAGG - Intergenic
950537029 3:13584651-13584673 GCCTCCCTCAAGAAAGAGCAGGG + Intronic
950622493 3:14216917-14216939 ACTTCATTGCAGAAAGAGCACGG + Intergenic
953262562 3:41353980-41354002 GCCCCACAATGGAAAGAGCATGG - Intronic
953491101 3:43351813-43351835 GAGTCACTGCAGATAGAGCAGGG - Intronic
955757586 3:62240989-62241011 TCCTCACTGCAGATAGATCAAGG + Intronic
955957500 3:64305518-64305540 GCCAAACTGGGGAAAGAGAAAGG - Intronic
959723107 3:109514168-109514190 GCCTCACTGGGGGAAGTGCAAGG - Intergenic
964114377 3:153120472-153120494 GGCCCACTGTGGAAAGAGAACGG - Intergenic
964276361 3:155012543-155012565 GCCCCACTGCGGGAAGAGGCAGG - Intergenic
965210635 3:165782363-165782385 GCCTCACAGGGTAAAGAGAAGGG + Intronic
967152734 3:186664662-186664684 CACTCACTGCGGATAGAACAGGG + Intronic
967977715 3:195044729-195044751 TGCTCACTGCGGAAAGGGTAGGG - Intergenic
968007827 3:195255075-195255097 CCAGCACTGCGGACAGAGCAGGG + Intronic
968656165 4:1779364-1779386 GCCTCACTTGGGAGAGAGCTTGG + Intergenic
972927130 4:44023373-44023395 GCCTCACAGAGGAAAAATCAGGG - Intergenic
973362148 4:49175751-49175773 GCCTCACTCAGGAAAGTGCAAGG - Intergenic
974153124 4:58035914-58035936 GCCTCTCAGCTGAAAGAGCAAGG - Intergenic
975675239 4:76821347-76821369 TCCCCACTGAGGAAAGAGGAAGG + Intergenic
980608962 4:135131662-135131684 CCCTCACAGCTGACAGAGCAAGG + Intergenic
981014645 4:139961134-139961156 GCCTCTCTGGGGAAACAACATGG + Intronic
981094152 4:140761172-140761194 GCCCCACTTTGGAAATAGCATGG + Intergenic
982157484 4:152536158-152536180 GCCTCAGAGCGGAAAGAAGAGGG - Intergenic
982169783 4:152649697-152649719 CCATCACTGGGGAAAGAGAAAGG - Intronic
984918405 4:184743425-184743447 GTCTAACTGCGGAAGCAGCATGG - Intergenic
989309781 5:40001203-40001225 GCCTCACTGGATAAAGAGTATGG - Intergenic
994549028 5:101207518-101207540 TCCTCACTATGGAAATAGCATGG - Intergenic
998132259 5:139657375-139657397 GCCTCAAAGAGGAAAGAGCAAGG - Intronic
1002211061 5:177599825-177599847 GCCTCCCCTCGGAAAGAGGACGG + Intergenic
1002528115 5:179826465-179826487 GCCTCAAAGTGGAATGAGCAAGG - Intronic
1003788605 6:9516394-9516416 GACTCACAGGAGAAAGAGCAAGG - Intergenic
1005046472 6:21647783-21647805 GTCTCACTATGGAAAGAGCAAGG + Intergenic
1007313776 6:40967868-40967890 GGCACACTGGGGAGAGAGCATGG - Intergenic
1011788496 6:90872183-90872205 GCCTGTCTGCTGAAATAGCAAGG + Intergenic
1012593836 6:101017158-101017180 GCCTCATGGAGAAAAGAGCAGGG - Intergenic
1013426316 6:110016014-110016036 TCCTCACTGCGGGAAGCTCATGG - Intergenic
1014571614 6:123015743-123015765 GGCTCACTGGGAAAAGAACATGG - Intronic
1016972684 6:149779098-149779120 GCCTCTCTGCGCATAGAGGAGGG - Intronic
1018642477 6:165917297-165917319 GTCTCACTGCACCAAGAGCATGG + Intronic
1019310204 7:356825-356847 GCCTCCCTGGGGAGAGAGGAGGG - Intergenic
1022615557 7:31926663-31926685 GCCTCACCTGGGAAAGTGCAAGG + Intronic
1023057149 7:36299724-36299746 GCCTCGCTGCAGTGAGAGCATGG + Exonic
1023241436 7:38151625-38151647 GCTACACTGCAGAAAGAACAGGG + Intergenic
1029604251 7:101589153-101589175 GCCTCCCTGGAGAGAGAGCATGG + Intergenic
1033360938 7:140638749-140638771 GCCTCACCAAGGAAACAGCAGGG - Intronic
1033560963 7:142529855-142529877 TCCTTGCTGAGGAAAGAGCAGGG - Intergenic
1034310591 7:150084505-150084527 GCCTCACTGCGGAGGTATCATGG + Intergenic
1034981912 7:155484592-155484614 GCCTGACTGCAGACACAGCACGG - Intronic
1036642077 8:10590987-10591009 CCCTCACTTCAGAAAGGGCAAGG + Intergenic
1038107717 8:24454594-24454616 GCCTCACCCCGGGAAGCGCAAGG - Intronic
1039957973 8:42221834-42221856 GCTGCACTGTGGAGAGAGCAGGG - Intergenic
1041952157 8:63515655-63515677 GCCTCACCCAGGAATGAGCAAGG + Intergenic
1047214627 8:122866224-122866246 ACCTCACTGGGGAAGGAACAGGG - Intronic
1048369499 8:133765369-133765391 TCCTCACTGAGGAAGGAGGAAGG - Intergenic
1049001948 8:139831871-139831893 GAAGCACTGTGGAAAGAGCACGG - Intronic
1049197951 8:141325743-141325765 GCAGCGCTGCGGAAACAGCAAGG + Intergenic
1051129152 9:13840204-13840226 GCTGCACAGCCGAAAGAGCAGGG - Intergenic
1053218609 9:36293128-36293150 CCTTCACTGAGGAGAGAGCAGGG + Intronic
1056233504 9:84569961-84569983 GCTTCACTGCCTAAGGAGCAAGG + Intergenic
1056936590 9:90919476-90919498 GCCACACTGAGGAAAGAGACTGG + Intergenic
1058061195 9:100497808-100497830 GACTCTCTGGGAAAAGAGCAAGG - Intronic
1059451391 9:114373235-114373257 GCCTCACTCAGAAAAGAGGAAGG + Intronic
1059958624 9:119543862-119543884 GCCTCACTGCACAATGAGTAGGG + Intergenic
1060344458 9:122804092-122804114 GCCTCTCTGGGGACAGAGAAAGG - Intronic
1060934233 9:127506374-127506396 CCCTAACTGCGGAAGGAGCAGGG + Exonic
1185455948 X:311049-311071 GGCTCACGGCGGCAAGAACATGG + Intronic
1186188244 X:7042761-7042783 GCCTCACTGCAGAAATGGCATGG - Intergenic
1191146260 X:57168348-57168370 TCCTCTCTGCTGATAGAGCAAGG + Intergenic
1199947808 X:152681850-152681872 TGCTCTCTGCGGAAACAGCAGGG - Intergenic
1199961871 X:152786604-152786626 TGCTCTCTGCGGAAACAGCAGGG + Intergenic
1200066085 X:153504678-153504700 GCCTCTCTGCTCAAAGGGCAGGG - Exonic