ID: 1123024893 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:105419922-105419944 |
| Sequence | GGCGCCGCAGGCGTTTAAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 21 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 19} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1123024893_1123024907 | 11 | Left | 1123024893 | 14:105419922-105419944 | CCCCTTTAAACGCCTGCGGCGCC | 0: 1 1: 0 2: 0 3: 1 4: 19 |
||
| Right | 1123024907 | 14:105419956-105419978 | CCATCGCGCCTCCATTTTCCCGG | 0: 1 1: 0 2: 1 3: 6 4: 72 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1123024893 | Original CRISPR | GGCGCCGCAGGCGTTTAAAG GGG (reversed) | Exonic | ||