ID: 1123024895

View in Genome Browser
Species Human (GRCh38)
Location 14:105419924-105419946
Sequence GGGGCGCCGCAGGCGTTTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123024895_1123024907 9 Left 1123024895 14:105419924-105419946 CCTTTAAACGCCTGCGGCGCCCC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1123024907 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123024895 Original CRISPR GGGGCGCCGCAGGCGTTTAA AGG (reversed) Exonic