ID: 1123024897

View in Genome Browser
Species Human (GRCh38)
Location 14:105419943-105419965
Sequence GGCGCGATGGCGGGGGCGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 973
Summary {0: 1, 1: 0, 2: 7, 3: 98, 4: 867}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123024897_1123024907 -10 Left 1123024897 14:105419943-105419965 CCCCCCGCCCCCGCCATCGCGCC 0: 1
1: 0
2: 7
3: 98
4: 867
Right 1123024907 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 72
1123024897_1123024915 21 Left 1123024897 14:105419943-105419965 CCCCCCGCCCCCGCCATCGCGCC 0: 1
1: 0
2: 7
3: 98
4: 867
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024897_1123024917 22 Left 1123024897 14:105419943-105419965 CCCCCCGCCCCCGCCATCGCGCC 0: 1
1: 0
2: 7
3: 98
4: 867
Right 1123024917 14:105419988-105420010 CCGAGCGCCGCGCCCGCCCCGGG 0: 1
1: 0
2: 6
3: 54
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123024897 Original CRISPR GGCGCGATGGCGGGGGCGGG GGG (reversed) Exonic