ID: 1123024907

View in Genome Browser
Species Human (GRCh38)
Location 14:105419956-105419978
Sequence CCATCGCGCCTCCATTTTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123024894_1123024907 10 Left 1123024894 14:105419923-105419945 CCCTTTAAACGCCTGCGGCGCCC 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1123024907 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 72
1123024896_1123024907 -1 Left 1123024896 14:105419934-105419956 CCTGCGGCGCCCCCCGCCCCCGC 0: 1
1: 2
2: 29
3: 287
4: 1836
Right 1123024907 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 72
1123024897_1123024907 -10 Left 1123024897 14:105419943-105419965 CCCCCCGCCCCCGCCATCGCGCC 0: 1
1: 0
2: 7
3: 98
4: 867
Right 1123024907 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 72
1123024893_1123024907 11 Left 1123024893 14:105419922-105419944 CCCCTTTAAACGCCTGCGGCGCC 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1123024907 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 72
1123024895_1123024907 9 Left 1123024895 14:105419924-105419946 CCTTTAAACGCCTGCGGCGCCCC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 1123024907 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 1
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123024907 Original CRISPR CCATCGCGCCTCCATTTTCC CGG Exonic