ID: 1123024915

View in Genome Browser
Species Human (GRCh38)
Location 14:105419987-105420009
Sequence GCCGAGCGCCGCGCCCGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 296}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123024903_1123024915 13 Left 1123024903 14:105419951-105419973 CCCCGCCATCGCGCCTCCATTTT 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024908_1123024915 0 Left 1123024908 14:105419964-105419986 CCTCCATTTTCCCGGCCGCCCGC 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024901_1123024915 17 Left 1123024901 14:105419947-105419969 CCGCCCCCGCCATCGCGCCTCCA 0: 1
1: 0
2: 0
3: 17
4: 324
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024909_1123024915 -3 Left 1123024909 14:105419967-105419989 CCATTTTCCCGGCCGCCCGCGCC 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024897_1123024915 21 Left 1123024897 14:105419943-105419965 CCCCCCGCCCCCGCCATCGCGCC 0: 1
1: 0
2: 7
3: 98
4: 867
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024900_1123024915 18 Left 1123024900 14:105419946-105419968 CCCGCCCCCGCCATCGCGCCTCC 0: 1
1: 0
2: 1
3: 42
4: 555
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024906_1123024915 8 Left 1123024906 14:105419956-105419978 CCATCGCGCCTCCATTTTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 58
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024902_1123024915 14 Left 1123024902 14:105419950-105419972 CCCCCGCCATCGCGCCTCCATTT 0: 1
1: 0
2: 2
3: 9
4: 69
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024899_1123024915 19 Left 1123024899 14:105419945-105419967 CCCCGCCCCCGCCATCGCGCCTC 0: 1
1: 0
2: 3
3: 49
4: 494
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024910_1123024915 -10 Left 1123024910 14:105419974-105419996 CCCGGCCGCCCGCGCCGAGCGCC 0: 1
1: 3
2: 6
3: 42
4: 390
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024904_1123024915 12 Left 1123024904 14:105419952-105419974 CCCGCCATCGCGCCTCCATTTTC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024896_1123024915 30 Left 1123024896 14:105419934-105419956 CCTGCGGCGCCCCCCGCCCCCGC 0: 1
1: 2
2: 29
3: 287
4: 1836
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024905_1123024915 11 Left 1123024905 14:105419953-105419975 CCGCCATCGCGCCTCCATTTTCC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296
1123024898_1123024915 20 Left 1123024898 14:105419944-105419966 CCCCCGCCCCCGCCATCGCGCCT 0: 1
1: 0
2: 3
3: 101
4: 754
Right 1123024915 14:105419987-105420009 GCCGAGCGCCGCGCCCGCCCCGG 0: 1
1: 0
2: 1
3: 32
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123024915 Original CRISPR GCCGAGCGCCGCGCCCGCCC CGG Exonic