ID: 1123025783

View in Genome Browser
Species Human (GRCh38)
Location 14:105423090-105423112
Sequence CGCCTGCAGCTTGCTCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123025777_1123025783 12 Left 1123025777 14:105423055-105423077 CCAAAACAGGACAGCAGGAATCG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1123025783 14:105423090-105423112 CGCCTGCAGCTTGCTCATGTGGG 0: 1
1: 0
2: 0
3: 3
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123025783 Original CRISPR CGCCTGCAGCTTGCTCATGT GGG Intronic
900086630 1:901395-901417 AGCCTTCAGTTTGCTCAGGTGGG + Intergenic
900124409 1:1063090-1063112 CGCCTCCACCCTGCTGATGTTGG - Intergenic
902450077 1:16491242-16491264 GGCCTGCAGCTTGCGCTGGTAGG + Intergenic
902504389 1:16929955-16929977 GGCCTGCAGCTTGCGCCGGTAGG - Exonic
902686155 1:18079085-18079107 CGCCTGGAGAGTACTCATGTGGG - Intergenic
903622175 1:24705709-24705731 TTCCTGCTGCTTGCTCATTTTGG + Intergenic
904559669 1:31387953-31387975 GGCCTGCAGCTGGCCCATGGTGG + Intergenic
908942738 1:69455156-69455178 TGCCTGCAGCTCTCTCAGGTTGG - Intergenic
917001600 1:170367265-170367287 GACCTGCAGGTGGCTCATGTGGG + Intergenic
1066370742 10:34815864-34815886 AGCCTGCAGCTTGCTCGGCTGGG + Intergenic
1066667822 10:37803407-37803429 TGCCTGCCCCTTGCTCATGCTGG + Intronic
1070828524 10:79404952-79404974 CCCCTGGAGCTTGCTCTTGAAGG - Intronic
1071798268 10:89029190-89029212 AGCCTGAAGCCTGTTCATGTGGG + Intergenic
1075100891 10:119505392-119505414 GGCGTGCAGCTTGCAGATGTGGG - Intronic
1075680727 10:124329345-124329367 CTCCTCCAGCTTGCTCTTGATGG - Intergenic
1076106323 10:127826567-127826589 CCACTGCAGCCTGCTCATGAGGG - Intergenic
1079106040 11:17573094-17573116 GGCCTGCAGCGTGCTCACGGGGG + Exonic
1081110902 11:39131905-39131927 CTCCTGAAGCTTGATCATGGTGG - Intergenic
1081736679 11:45409325-45409347 CGGGTGCAGGTTGCTCATGTCGG + Intergenic
1084652318 11:70496420-70496442 AGCCTGCAGCCTGTTCATTTTGG - Intronic
1096446595 12:51698445-51698467 CGCCTGCCTCTTGCTCATCCTGG + Intronic
1096530353 12:52238693-52238715 CAGCTCCACCTTGCTCATGTAGG - Exonic
1098715821 12:73827692-73827714 CATTTGCAGCTTGCTCATTTTGG - Intergenic
1104847549 12:131854246-131854268 CGCCTGCACCTTCCTCGTGATGG + Intergenic
1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG + Intronic
1105418968 13:20236142-20236164 TGCCTGCAGCTTTCCCAGGTTGG + Intergenic
1106129193 13:26925520-26925542 CAACTGCAGCTTGCATATGTGGG + Intergenic
1114627206 14:24137340-24137362 GGCCTTCAGATTGCTCAAGTTGG - Exonic
1121108980 14:91299611-91299633 AGCCTGCCTCTTGCTCATGAAGG - Intronic
1123025783 14:105423090-105423112 CGCCTGCAGCTTGCTCATGTGGG + Intronic
1126185850 15:45829779-45829801 CGCCTGCAGCCTGCAGATCTGGG - Intergenic
1126358611 15:47822538-47822560 CTCCAGCAGCCTTCTCATGTGGG + Intergenic
1133035315 16:3030930-3030952 AGCCAGCAGCTGGCTCAGGTGGG - Exonic
1143976240 17:10831973-10831995 AGCCTGCAGCCTGCTCAGCTTGG - Intronic
1146892438 17:36514727-36514749 CCCCTGCATCTAGCTCAGGTGGG + Intronic
1147951327 17:44109547-44109569 CCCATGCAGTTTTCTCATGTAGG - Intronic
1150015855 17:61556408-61556430 CGCTTGGAGGTTGCTCTTGTAGG - Intergenic
1151582322 17:74987600-74987622 CGCCTGCAGCTTGCGGAGCTCGG - Intergenic
1159118982 18:64147858-64147880 AGCCTGCATCTTGCCCAGGTTGG + Intergenic
1160384189 18:78485120-78485142 TGCCTGCAGCCTCCTCCTGTTGG + Intergenic
1160384300 18:78485665-78485687 CGCCTGCAGCCTCCTCCTGATGG + Intergenic
1160384352 18:78485917-78485939 CGCCTGCAGCCTCCTCCTGATGG + Intergenic
1160384414 18:78486212-78486234 CGCCTGCAGCCTCCTCCTGATGG + Intergenic
1160384487 18:78486553-78486575 CGCCTGCAGCCTCCTCCTGATGG + Intergenic
1160490008 18:79329030-79329052 CTTCTGCAGCTGTCTCATGTTGG + Intronic
1161395257 19:4042127-4042149 CTCCTTCAGCTTCCCCATGTGGG + Intergenic
1163749971 19:19070878-19070900 CCCCTCCAGATGGCTCATGTTGG + Intronic
1166189612 19:41167324-41167346 CGCTTGCACCTTGCACCTGTTGG + Intergenic
1166813785 19:45529301-45529323 CGCCTGCAGCTGCCTGATGCTGG - Exonic
931496564 2:62813559-62813581 CGCCTGCAGCTTTCCCAGGCTGG - Intronic
938005233 2:127784457-127784479 ACCCTGCAGCTTGACCATGTAGG + Intronic
938223867 2:129598278-129598300 TGCCTTCAGGTTCCTCATGTGGG - Intergenic
945790006 2:214293325-214293347 GACCTGCAGCTGGCTCATATGGG + Intronic
948013832 2:234671785-234671807 CCTCTGCATCTTTCTCATGTGGG - Intergenic
1170341591 20:15334108-15334130 AGCCTTCAGTTTGCTCATGAGGG - Intronic
1171073182 20:22095087-22095109 CGCCAGCAGCTTGCCCCTCTTGG + Intergenic
1171958156 20:31475385-31475407 CGCCGCCAACTTGCTCAAGTTGG + Intronic
1179947219 21:44686517-44686539 GGCCTGCCGCATGCTCAGGTCGG + Intronic
1180868621 22:19133813-19133835 CACCTGCAGCTTCCTCACCTGGG + Exonic
1181447222 22:22986532-22986554 CTCCTCCTGCTTGCTCAGGTTGG + Intergenic
1185113614 22:48918760-48918782 CGCCTGGATGTTGCTCATGGTGG - Intergenic
950849202 3:16046088-16046110 CACGTGCAGCTGGCTCAAGTGGG + Intergenic
953183241 3:40615738-40615760 CGCCTGCAGATTGCGCAGGCTGG - Intergenic
953463465 3:43099760-43099782 CTCCTTCTGCTTGCTGATGTGGG - Intronic
960971223 3:123141533-123141555 CTCCTGCAGTTTGTTCATGCAGG + Intronic
961455631 3:127022591-127022613 CGCCTGCTGCCCACTCATGTGGG + Intronic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
972082722 4:35173380-35173402 TGCCTGCAGCTTTCTCAGGCTGG - Intergenic
978193055 4:105938384-105938406 GGCCTGCAGCTGGCTCCTGATGG + Exonic
980770941 4:137372461-137372483 GGCCTGCAGTTTCCTCATGCTGG + Intergenic
982396085 4:154917432-154917454 CACCTGCAGCTTGCTCACTGGGG + Intergenic
991427717 5:66508854-66508876 TGCCAACAGATTGCTCATGTTGG + Intergenic
992849745 5:80794930-80794952 CCCCTGCAGCTCTCTCATTTGGG - Intronic
998772724 5:145564842-145564864 CTCCTGAAGCTTTCTCATTTTGG - Intronic
998875483 5:146594744-146594766 TGCCTCCAGCTTGCTCTGGTGGG + Intronic
999424522 5:151475698-151475720 GGCCTGCAGCAGGATCATGTTGG + Intronic
1001253903 5:170169229-170169251 AGCCAGAAGCTTGCTCCTGTGGG - Intergenic
1002823002 6:745863-745885 TGTCTGCAGCTAGCTCATCTTGG - Intergenic
1004198468 6:13526749-13526771 CACCTGCAGCTTGCTGTTTTAGG - Intergenic
1004426265 6:15509400-15509422 CGGCTGCAGCCTCCTCATTTTGG + Intronic
1004734406 6:18390951-18390973 CACCTGCACTTTGCTCAGGTGGG + Intronic
1005187563 6:23180369-23180391 CGCCTGCAGCTTGCTGGGGGTGG - Intergenic
1007728141 6:43929250-43929272 GGGCTAGAGCTTGCTCATGTTGG - Intergenic
1008011761 6:46475276-46475298 TGCCAGAAGCTTGCTCAAGTGGG - Intronic
1008789792 6:55216731-55216753 TGCCTGCAGCTTTCCCAGGTGGG + Intronic
1012834848 6:104252110-104252132 TGCCTGCAGCTTTCTCAGGCTGG - Intergenic
1013343694 6:109239246-109239268 AGCCTGCTGCTTGTCCATGTGGG + Intergenic
1017632279 6:156408031-156408053 TGCCTGCAGCTTGCCGATCTAGG - Intergenic
1019005877 6:168795835-168795857 CGCCTGCAGCTGGCTCTTCTGGG + Intergenic
1019005885 6:168795886-168795908 CGCCTGCAGCTGGCTCTTCCGGG + Intergenic
1019005896 6:168795937-168795959 CGCCTGCAGCTGGCTCTTCCGGG + Intergenic
1019005907 6:168795988-168796010 CGCCTGCAGCTGGCTCTTCCGGG + Intergenic
1019005918 6:168796039-168796061 CGCCTGCAGCTGGCTCTTCCGGG + Intergenic
1019005929 6:168796090-168796112 CGCCTGCAGCTGGCTCTTCCGGG + Intergenic
1019005940 6:168796141-168796163 CGCCTGCAGCTGGCTCTTCCGGG + Intergenic
1019005951 6:168796192-168796214 CGCCTGCAGCTGGCTCTTCTGGG + Intergenic
1019005960 6:168796243-168796265 CGCCTACAGCTGGCTCTTCTGGG + Intergenic
1019005977 6:168796345-168796367 TGCCTGCAGCTGGCTCTTCTGGG + Intergenic
1019211303 6:170407500-170407522 CGCCTGTATCTGGCTCATGCTGG + Intergenic
1024379840 7:48683763-48683785 AGTCTGCAGCTTGGTCATTTAGG - Intergenic
1028771988 7:94636567-94636589 GGCCCTCAGCTTGCTCAAGTAGG + Intronic
1039547605 8:38421138-38421160 AGCCTGCAGCCTGCTCAGGGTGG - Intronic
1039973313 8:42338620-42338642 CGCCTTCCGTTTGCTCATGGCGG - Exonic
1040621936 8:49101288-49101310 CCCCTGCAGCTTGCTTCTGATGG + Intergenic
1049773641 8:144395008-144395030 CTCCTGCAGCTCGATCCTGTGGG + Exonic
1055171661 9:73266294-73266316 TGCCTGTAGCTTTCTCAGGTAGG - Intergenic
1057227058 9:93297990-93298012 TGCCTTCAGCTTGCTCTTGCTGG - Exonic
1059686255 9:116639593-116639615 AGCCTGCAGCTTGCTCTTCCTGG + Intronic
1061191598 9:129085638-129085660 TGCCTGCACCCTGCCCATGTGGG + Intronic
1062079901 9:134618300-134618322 TTCGTGCAGCTTGCACATGTGGG + Intergenic
1062578655 9:137220220-137220242 GGACTGAAGCTTGCTCCTGTGGG - Intergenic
1196723419 X:118875612-118875634 TGCCTGCAGCTTTCCCAGGTTGG - Intergenic