ID: 1123026725

View in Genome Browser
Species Human (GRCh38)
Location 14:105428176-105428198
Sequence GGGAGCTGGGGGAGAAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2632
Summary {0: 1, 1: 1, 2: 21, 3: 307, 4: 2302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026725_1123026738 30 Left 1123026725 14:105428176-105428198 CCCCCTCTTCTCCCCCAGCTCCC 0: 1
1: 1
2: 21
3: 307
4: 2302
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026725 Original CRISPR GGGAGCTGGGGGAGAAGAGG GGG (reversed) Intronic