ID: 1123026727

View in Genome Browser
Species Human (GRCh38)
Location 14:105428178-105428200
Sequence CTGGGAGCTGGGGGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1310
Summary {0: 1, 1: 0, 2: 12, 3: 148, 4: 1149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026727_1123026738 28 Left 1123026727 14:105428178-105428200 CCCTCTTCTCCCCCAGCTCCCAG 0: 1
1: 0
2: 12
3: 148
4: 1149
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026727 Original CRISPR CTGGGAGCTGGGGGAGAAGA GGG (reversed) Intronic