ID: 1123026728

View in Genome Browser
Species Human (GRCh38)
Location 14:105428179-105428201
Sequence GCTGGGAGCTGGGGGAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1690
Summary {0: 1, 1: 0, 2: 23, 3: 192, 4: 1474}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026728_1123026738 27 Left 1123026728 14:105428179-105428201 CCTCTTCTCCCCCAGCTCCCAGC 0: 1
1: 0
2: 23
3: 192
4: 1474
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026728 Original CRISPR GCTGGGAGCTGGGGGAGAAG AGG (reversed) Intronic