ID: 1123026730

View in Genome Browser
Species Human (GRCh38)
Location 14:105428188-105428210
Sequence GTCAGTGTTGCTGGGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 0, 3: 59, 4: 459}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026730_1123026738 18 Left 1123026730 14:105428188-105428210 CCCCAGCTCCCAGCAACACTGAC 0: 1
1: 0
2: 0
3: 59
4: 459
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026730_1123026740 27 Left 1123026730 14:105428188-105428210 CCCCAGCTCCCAGCAACACTGAC 0: 1
1: 0
2: 0
3: 59
4: 459
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026730 Original CRISPR GTCAGTGTTGCTGGGAGCTG GGG (reversed) Intronic