ID: 1123026731

View in Genome Browser
Species Human (GRCh38)
Location 14:105428189-105428211
Sequence GGTCAGTGTTGCTGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026731_1123026740 26 Left 1123026731 14:105428189-105428211 CCCAGCTCCCAGCAACACTGACC 0: 1
1: 0
2: 2
3: 31
4: 307
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026731_1123026738 17 Left 1123026731 14:105428189-105428211 CCCAGCTCCCAGCAACACTGACC 0: 1
1: 0
2: 2
3: 31
4: 307
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026731 Original CRISPR GGTCAGTGTTGCTGGGAGCT GGG (reversed) Intronic