ID: 1123026734 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:105428197-105428219 |
Sequence | AGAAAATAGGTCAGTGTTGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 390 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 35, 4: 354} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123026734_1123026738 | 9 | Left | 1123026734 | 14:105428197-105428219 | CCAGCAACACTGACCTATTTTCT | 0: 1 1: 0 2: 0 3: 35 4: 354 |
||
Right | 1123026738 | 14:105428229-105428251 | GTTTTGCCTTGTCCAGAATGTGG | 0: 1 1: 3 2: 3 3: 19 4: 157 |
||||
1123026734_1123026740 | 18 | Left | 1123026734 | 14:105428197-105428219 | CCAGCAACACTGACCTATTTTCT | 0: 1 1: 0 2: 0 3: 35 4: 354 |
||
Right | 1123026740 | 14:105428238-105428260 | TGTCCAGAATGTGGTAGAAGTGG | 0: 1 1: 0 2: 4 3: 25 4: 290 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123026734 | Original CRISPR | AGAAAATAGGTCAGTGTTGC TGG (reversed) | Intronic | ||