ID: 1123026734

View in Genome Browser
Species Human (GRCh38)
Location 14:105428197-105428219
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026734_1123026738 9 Left 1123026734 14:105428197-105428219 CCAGCAACACTGACCTATTTTCT 0: 1
1: 0
2: 0
3: 35
4: 354
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026734_1123026740 18 Left 1123026734 14:105428197-105428219 CCAGCAACACTGACCTATTTTCT 0: 1
1: 0
2: 0
3: 35
4: 354
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026734 Original CRISPR AGAAAATAGGTCAGTGTTGC TGG (reversed) Intronic