ID: 1123026735

View in Genome Browser
Species Human (GRCh38)
Location 14:105428210-105428232
Sequence AAACGGCAGGAACAGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026735_1123026738 -4 Left 1123026735 14:105428210-105428232 CCTATTTTCTGTTCCTGCCGTTT 0: 1
1: 0
2: 2
3: 19
4: 296
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026735_1123026740 5 Left 1123026735 14:105428210-105428232 CCTATTTTCTGTTCCTGCCGTTT 0: 1
1: 0
2: 2
3: 19
4: 296
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026735_1123026742 22 Left 1123026735 14:105428210-105428232 CCTATTTTCTGTTCCTGCCGTTT 0: 1
1: 0
2: 2
3: 19
4: 296
Right 1123026742 14:105428255-105428277 AAGTGGAATTGCACAGCATGTGG 0: 1
1: 0
2: 5
3: 39
4: 306
1123026735_1123026743 23 Left 1123026735 14:105428210-105428232 CCTATTTTCTGTTCCTGCCGTTT 0: 1
1: 0
2: 2
3: 19
4: 296
Right 1123026743 14:105428256-105428278 AGTGGAATTGCACAGCATGTGGG 0: 1
1: 0
2: 0
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026735 Original CRISPR AAACGGCAGGAACAGAAAAT AGG (reversed) Intronic