ID: 1123026736

View in Genome Browser
Species Human (GRCh38)
Location 14:105428223-105428245
Sequence TCTGGACAAGGCAAAACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 450}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026736_1123026744 23 Left 1123026736 14:105428223-105428245 CCTGCCGTTTTGCCTTGTCCAGA 0: 1
1: 0
2: 1
3: 39
4: 450
Right 1123026744 14:105428269-105428291 AGCATGTGGGCTTTTGAGTCTGG 0: 1
1: 3
2: 17
3: 169
4: 1065
1123026736_1123026742 9 Left 1123026736 14:105428223-105428245 CCTGCCGTTTTGCCTTGTCCAGA 0: 1
1: 0
2: 1
3: 39
4: 450
Right 1123026742 14:105428255-105428277 AAGTGGAATTGCACAGCATGTGG 0: 1
1: 0
2: 5
3: 39
4: 306
1123026736_1123026743 10 Left 1123026736 14:105428223-105428245 CCTGCCGTTTTGCCTTGTCCAGA 0: 1
1: 0
2: 1
3: 39
4: 450
Right 1123026743 14:105428256-105428278 AGTGGAATTGCACAGCATGTGGG 0: 1
1: 0
2: 0
3: 19
4: 149
1123026736_1123026740 -8 Left 1123026736 14:105428223-105428245 CCTGCCGTTTTGCCTTGTCCAGA 0: 1
1: 0
2: 1
3: 39
4: 450
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026736 Original CRISPR TCTGGACAAGGCAAAACGGC AGG (reversed) Intronic