ID: 1123026738

View in Genome Browser
Species Human (GRCh38)
Location 14:105428229-105428251
Sequence GTTTTGCCTTGTCCAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 3, 2: 3, 3: 19, 4: 157}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026726_1123026738 29 Left 1123026726 14:105428177-105428199 CCCCTCTTCTCCCCCAGCTCCCA 0: 1
1: 0
2: 14
3: 166
4: 1466
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026733_1123026738 10 Left 1123026733 14:105428196-105428218 CCCAGCAACACTGACCTATTTTC 0: 1
1: 1
2: 2
3: 31
4: 244
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026727_1123026738 28 Left 1123026727 14:105428178-105428200 CCCTCTTCTCCCCCAGCTCCCAG 0: 1
1: 0
2: 12
3: 148
4: 1149
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026725_1123026738 30 Left 1123026725 14:105428176-105428198 CCCCCTCTTCTCCCCCAGCTCCC 0: 1
1: 1
2: 21
3: 307
4: 2302
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026735_1123026738 -4 Left 1123026735 14:105428210-105428232 CCTATTTTCTGTTCCTGCCGTTT 0: 1
1: 0
2: 2
3: 19
4: 296
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026732_1123026738 16 Left 1123026732 14:105428190-105428212 CCAGCTCCCAGCAACACTGACCT 0: 1
1: 1
2: 1
3: 33
4: 350
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026731_1123026738 17 Left 1123026731 14:105428189-105428211 CCCAGCTCCCAGCAACACTGACC 0: 1
1: 0
2: 2
3: 31
4: 307
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026734_1123026738 9 Left 1123026734 14:105428197-105428219 CCAGCAACACTGACCTATTTTCT 0: 1
1: 0
2: 0
3: 35
4: 354
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026730_1123026738 18 Left 1123026730 14:105428188-105428210 CCCCAGCTCCCAGCAACACTGAC 0: 1
1: 0
2: 0
3: 59
4: 459
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026728_1123026738 27 Left 1123026728 14:105428179-105428201 CCTCTTCTCCCCCAGCTCCCAGC 0: 1
1: 0
2: 23
3: 192
4: 1474
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157
1123026729_1123026738 19 Left 1123026729 14:105428187-105428209 CCCCCAGCTCCCAGCAACACTGA 0: 1
1: 0
2: 3
3: 57
4: 418
Right 1123026738 14:105428229-105428251 GTTTTGCCTTGTCCAGAATGTGG 0: 1
1: 3
2: 3
3: 19
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026738 Original CRISPR GTTTTGCCTTGTCCAGAATG TGG Intronic