ID: 1123026740

View in Genome Browser
Species Human (GRCh38)
Location 14:105428238-105428260
Sequence TGTCCAGAATGTGGTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 290}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123026733_1123026740 19 Left 1123026733 14:105428196-105428218 CCCAGCAACACTGACCTATTTTC 0: 1
1: 1
2: 2
3: 31
4: 244
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026731_1123026740 26 Left 1123026731 14:105428189-105428211 CCCAGCTCCCAGCAACACTGACC 0: 1
1: 0
2: 2
3: 31
4: 307
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026736_1123026740 -8 Left 1123026736 14:105428223-105428245 CCTGCCGTTTTGCCTTGTCCAGA 0: 1
1: 0
2: 1
3: 39
4: 450
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026730_1123026740 27 Left 1123026730 14:105428188-105428210 CCCCAGCTCCCAGCAACACTGAC 0: 1
1: 0
2: 0
3: 59
4: 459
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026732_1123026740 25 Left 1123026732 14:105428190-105428212 CCAGCTCCCAGCAACACTGACCT 0: 1
1: 1
2: 1
3: 33
4: 350
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026729_1123026740 28 Left 1123026729 14:105428187-105428209 CCCCCAGCTCCCAGCAACACTGA 0: 1
1: 0
2: 3
3: 57
4: 418
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026734_1123026740 18 Left 1123026734 14:105428197-105428219 CCAGCAACACTGACCTATTTTCT 0: 1
1: 0
2: 0
3: 35
4: 354
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290
1123026735_1123026740 5 Left 1123026735 14:105428210-105428232 CCTATTTTCTGTTCCTGCCGTTT 0: 1
1: 0
2: 2
3: 19
4: 296
Right 1123026740 14:105428238-105428260 TGTCCAGAATGTGGTAGAAGTGG 0: 1
1: 0
2: 4
3: 25
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123026740 Original CRISPR TGTCCAGAATGTGGTAGAAG TGG Intronic